1.
Comparayive Efficacy Of Chemotherapeutic Trails Against Hypodermosis In Cattle In Rajanpur
by Muhammad Zahid | Dr. Aneela Zameer Durrani | Dr. Muhammad Hassan Saleem | Prof. Dr. Azhar.
Material type: ; Format:
print
Publisher: 2011Dissertation note: Study was carried out in district Rajanpur from February, 2011 to April, 2011 to find out percentage of infestation and to study chemotherapeutic trails against warble fly infestation in cattle in three tehsils namely Rojhan, Rajanpur and Jampur of district Rajanpur. In each tehsil 200 cattle were examined to record clinical signs of hypodermosis. For treatment of affected animals drug trail were done with Trichlorophon (Tagafon Star,Pakistan) and Ivermectin (Imec, SJG, Pakistan) 1% subcutaneously @ 0.2mg/kg body weight. Study included percentage of infestation in cattle in the households, veterinary hospitals and private farms. Average percentage of warbles in cattle was calculated and found 10 %, 17% and 16.5% in Rojhan, Rajanpur and Jampur respectively. It was found that percentage of infestation was 12% to 18% in hilly areas as compared to semi-hilly areas with 8% to16% and riverine areas 8% to 18% warble fly infestation in cattle. It was observed that warble fly infestation in cattle was absent in some plane areas in tehsil Jampur.
The comparison of different chemotherapeutic trails against Hypodermosis in cattle were observed and recorded. Three groups of cattle were made for chemotherapeutic trails against hypodermosis. Application of Tagafon in two different groups of cattle was carried out to evaluate their efficacy against Hypodemosis. In one group Trichlorophon (Tagafon Star,Pakistan) was applied with cotton gauzes by swabbing and spraying method with 5% solution of trichlorophon. In second group Trichlorophon (Tagafon Star, Pakistan) was given by drenching method with 2% solution at a dose rate of 0.2ml/kg body weight. In third group (Inj.Imec, SJG, Pakistan) Ivermectin 1% at dose rate of 0.2mg/kg body weight subcutaneous injection was carried out. Ivermectin1% was found to be 100% effective. Tagafon (Trichlorophon) was found 90% effective by swabbing and spraying method with 5% solution and Tagafon (Trichlorophon) by drenching method with 2% solution was found 85%effective against warble fly infestation in cattle in the study area. The data was analyzed statistically and found significant.
Availability: Items available for loan: UVAS Library [Call number: 1297,T] (1).
2.
Diagnosis And Treatment Of Strongylosis Using Neem Leaves And Ivermectin In Donkeys
by Muhammad waqas | Dr. Muhammad sarwar khan | Dr. aneela zameer durrani | Dr. Muhammad.
Material type: ; Format:
print
; Nature of contents: ; Literary form: Publisher: 2011Dissertation note: Donkeys act as draught animals and are used for a variety of purposes. Donkeys are still the "beasts of burden". Helminthes parasites, particularly strongyle nematodes, are the common inhabitants of the gastro-intestinal tracts of equines. Strongylosis is one of the most important parasitic diseases of equines. Diarrhea, anorexia, weight loss and moderate anaemia are the clinical signs in infected animal resulting in heavy mortality. The present project was therefore designed to investigate the infection rate of nematodes in donkeys, to calculate the efficacy of Ivermectin and Neem against strongylosis and to study the effect of strongylosis on various blood parameters (DLC and Hb).
Three hundred donkeys (n=300) were examined coprologically for the presence of nematodes. 167 donkeys were found infected with various parasites with the overall infection rate being 55.66%. Out of 167, 85 donkeys were infected with strongylus, 29 with trichostrongylus, 19 with trichonema, 19 with gastrodiscuss and 15 with mixed infection. So the infection rate for strongylus, trichostrongylus, trichonema, gastrodiscuss and mixed infection was 28.33%, 9.66%, 6.33%, 6.33% and 5% respectively. For drug trails thirty donkeys naturally infected with strongylosis were selected. These animals were divided into three groups A, B and C, comprising of 10 animals each. Another group D comprising of 10 healthy animals was also made. Group A was treated with ivermectin at the dose rate of 0.2 mg/kg body weight (1 ml/50 kg b w) once. Group B was treated with neem dry leaves at the dose rate of 375 mg/kg body weight mixed with wheat bran for four days. Group C was kept as positive control (Infected-Untreated) and Group D was kept as negative control (Uninfected-Untreated).
The faecal samples were collected on day zero pre-medication and on day 7 and 14 post-medication. The efficacies of ivermectin and neem were calculated on the basis of reduction in number of eggs per gram (EPG) of the faeces. The efficacy of ivermectin was 73.21 and 96.42% on day 7 and 14 respectively. The efficacy of neem was noted to be 22.22 and 33.33% on day 7 and 14 post-medication respectively. It was concluded that ivermectin was most effective. The blood samples were also collected on day zero (pre-medication) and on day 7 and 14 (post-medication) and were examined for hematology. Groups A, B and C had low haemoglobin values. The values get improved in groups A and B after treatments but the value further decreased in group C because this group was kept as infected control. The Hb value remained normal in group D as the animals in this group were healthy. In group C there was significant increase in eosinophils.
Availability: Items available for loan: UVAS Library [Call number: 1302,T] (1).
3.
Compaiativ Efficacy Of Different Electrolyte Solutions On Heat Stress And Their Efiect On Hematology And Blood
by Hafiz Tariq Mehmood | Dr. Aneela Zameer Durrani | Dr. Hassan Saleem | Prof. Dr. Azhar.
Material type: ; Format:
print
; Literary form:
not fiction
Publisher: 2011Dissertation note: The present project had been designed to study the effect of heat stress on cattle calves and to evaluate the efficacy of electrolytes solution (Normal Saline and Ringer Lactate) on various blood parameters. Five groups of calves comprising 10 in each group were selected for experimental study. Group A: Affected calves with heat stress were provided shade after taking TPR and the effect of shade were checked after one hour. Group B: Heat stressed calves of same age group were given Normal Saline IV according to their body weight and the effect were checked through TPR, hematology and blood electrolyte. Group C: Heat stressed calves of same age group were given Ringer's Lactate IV according to their body weight and the effect were checked through TPR, hematology and blood electrolyte. Group D: calves of same age group affected with heat stress were taken as the positive control. Group E: calves of same age group were normal healthy calves (negative control). Temperature was taken at regular intervals of one hour daily. Respiration was observed by placing the hand in front of nostrils. Heart rate was observed by stethoscope daily in morning and evening. The blood sample of each calf was collected both for control and experimental animals through disposable syringe from jugular vein. The blood was shifted to University Diagnostic laboratory, University of Veterinary and Animal Sciences Lahore. The samples were taken before and after therapeutic trials. Blood samples were taken for blood electrolyte examination and hematology. Serum of the blood was separated by centrifugation for electrolytes measurements. The flame photometer was utilized to measure the serum sodium (Na+) potassium (K+) Chloride (Cl+) and Bicarbonate (HCO3) concentration. The physical sign of experimental group before cooling were noted .sever sweating and panting were observed under physical sign. The pulse rate, respiration and rectal temperature of experimental group before cooling were increased. Changes found in CBC and blood electrolytes like sodium, potassium, chloride and bicarbonate were measure by flam photometry.
These all observation showed that the animal of experimental group before cooling were suffering from electrolyte imbalance ,but it was not so serious which may result in death of the animal, however the persistence of that condition might result in heat stroke which is often lethal.
It is concluded that serum electrolyte concentration, CBC and pulse rate, respiration and rectal temperature help in accessing the condition of animal suffering form the heat stress. From the present study it can be concluded that heat stress cause changes in biochemical and Hematological parameters in calves. These changes can be overcome by giving animal's fluid therapy and by providing good shade in hot summer. Further studied are required to Conducted on other species of animals to understand the effect of heat stress .Other biochemical and hematological parameters should be studied in bovine calves and other animals for the better understanding the effects of heat stress.
Availability: Items available for loan: UVAS Library [Call number: 1309,T] (1).
4.
Molecular Diagnosis Of Bovine Anaplasmosis In District Lahore
by Aqsa Mushtaq | Dr. Aneela Zameer Durrani | Dr. Hassan Saleem | Prof. Dr. Azhar.
Material type: ; Format:
print
Publisher: 2011Dissertation note: The present study was designed to determine diagnosis and infection percentage of Bovine anaplasmosis in cattle and buffalo of different age groups in and around District Lahore, and to study the comparative efficacy of diagnostic methods that is Polymerase chain reaction (PCR) and Microscopic Examination. For this purpose 160 blood samples were collected from cattle and buffaloes ,randomly from eight villages , during the month of May, June, July, August of 2010 in and around District Lahore.80 samples were collected from cattle and 80 were collected from buffaloes and these samples were further categorized into two age groups that is 40 samples were collected from calves of 1 month to 6 month of age and 40 samples were collected from calves of 7 month to 12 month of age of each species. Screening was done by blood smears, stained by Giemsa'wright staining technique and later the blood samples from the same animals were also processed by PCR.
The blood smears showed Anaplasma marginale as dense , round, deeply stained body, approximately 0.3-1.0um in diameter. Most of them were located on or near the margin of the erythrocyte.On the basis of Microscopic examination overall 11.25% (18\160) prevalence was recorded. On the basis of polymerase chain reaction (PCR) prevalence of Anaplasma marginale 25.6%(41\160) was recorded, showing the presence of carrier animals in District Lahore. The blood smears showed maximum prevelance in cattle of age 7 months to 12 months of age that is 20% (8\40) than animals of age 1 month to 6 month of age 10% (4\40).The blood smears showed maximum prevelance in buffalo calves of age 7 months to 12 months of age that is 10% (4\40) than animals of age 1 month to 6 month of age 5% (2\40). The blood smears showed that the prevelance of Bovine anaplasmosis is more in cattle 15% (12\80) than buffalo 7.5% (6\80). The overall prevalence 25.6% (41\160) was recorded for Bovine anaplasmosis , during summer season on the basis of PCR. The Polymerase chain reaction showed maximum prevelance in cattle of age 7 months to 12 months of age that is45 % (18\40) than animals of age 1 month to 6 month of age 20% (8\40). The Polymerase chain reaction showed maximum prevelance in buffalo animals of age 7 months to 12 months of age that is 27.5% (11\40) than animals of age 1 month to 6 month of age 10% (4\40). The Polymerase chain reaction showed that the prevelance of Bovine anaplasmosis is more in cattle 32.5% (26\80) than buffalo18.75 % (15\80).The results have shown high efficacy of PCR as compare to Microscopic Examination.
It is anticipated that present study was proved helpful in diagnosis of Anaplasma in infected as well as in carrier animals in District Lahore , and will be beneficial for further study.
Availability: Items available for loan: UVAS Library [Call number: 1346,T] (1).
5.
Dynamics Of Membrane Changes And Generation Of Reactive Oxygen Species During Bovine Sperm Death
by Mushtaq Ahmad | Prof. Dr. Nasim Ahmad | Dr. Amjad Riaz | Dr. Aneela Zameer Durrani.
Material type: ; Format:
print
Publisher: 2012Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 1430,T] (1).
6.
Pereentage Of Hemorrhagic Septieemia Carrier Buffalo And Their Immunity Status At District Swat, Khyber
by Ikramul Haq | Dr. Aneela Zameer Durrani | Dr. Ayesha | Dr. Jaweria Ali Khan.
Material type: ; Format:
print
Publisher: 2012Dissertation note: The study was conducted in District Swat, Khyber Pukhtoonkhwa province, to study the percentage of carrier buffaloes of hemorrhagic septicemia in the region and Immune status of buffaloes. Tracheal swabs and blood were collected from 200 buffaloes slaughtered at Saidu Sharif slaughter house. The selected buffaloes were divided into four age groups, the first group had animals of two and less than two years of age, the second had animals with age of three years, the third group, five years and fourth group had animals with age of more than five years. Tracheal swabs were cultured for the isolation of Pasteurella multocida, for identification of carrier animals and blood sample were processed to determine the antibodies titer of buffaloes against Pasteurella multocida.
The results showed that 8 (4%) out of total 200 examined buffaloes were identified as carriers of hemorrhagic septicemia by isolating the Pasteurella multocida from their tracheal swab. Out of 8 carrier buffaloes 4 were from group IV, 3 from Group III and 3 from group II. The percentage of carrier buffaloes in four age groups was 0%, 2%, 6% and 8% in group-I, group-II, group-III and group-IV respectively, showed that percentage of carrier buffaloes were high in group IV while lowest in group I. The Pathogenicity tests of the all 8 isolates showed that they were pathogenic to mice and cause their death within 24 hours of incubation.
Serological study of blood sample for antibodies titer showed that out of 200 buffaloes 156 (78%) showed antibodies titer ?1:16 which were considered immune against hemorrhagic septicemia. Out of 156, 17 were from group-I, 46 from group-II, 46 group-III and 47 from group-IV. Percentage of immune buffaloes in different age groups was 34%, 92%, 92% and 94% in group-I, group-II, group-III and group-IV respectively. The higher number of immune animals i:e 94% were in group-IV and the lowest were in group-I i:e 34%.
Results showed that all the carrier buffaloes had antibodies titer more than 1:16. The antibodies titer of the 4 carrier buffaloes were 64, 2 had 128 while 1, 1 had antibodies titer 16 and 32 respectively.
Availability: Items available for loan: UVAS Library [Call number: 1443,T] (1).
7.
A Study On Ticks And Hemoprotozoan Infections In Camels (Camelus Dromedarious) In District Dera Ismail
by Naimat Ullah | Dr. Aneela Zameer Durrani | Dr. Muhammad | Dr. Muhammad Ijaz.
Material type: ; Format:
print
; Nature of contents: ; Literary form: Publisher: 2013Dissertation note: Background
Pakistan is gifted with a large population of small ruminant including 58.3 and 27.4 million heads of goats and sheep respectively 2010.According to Livestock Census 2006, there were about 92164 sheep and 221912 goats' populations in Bannu district. Sheeps and goats are playing a leading role in the national economy by producing wool, skin, meat, milk and farm yard manure. Fasciolosis, parasitic gastrioenteritis, hydatidosis, coccidiosis, ectoparasitism, theleriosis and babesiosis are the major parasitic problems of small ruminants .There was an urgent need to carry out research on applied aspect leading control of parasites.
Study Objectives: The main objectives of the present study were;
(i) To have an overview on the overall prevalence of ectoparasites and endoparasites in small ruminants throughout the district by means of fecal tests.
(ii) To observe the affect of ecto and endoparasites on blood profile of the infected individuals.
Hypothesis: It was hypothesized that
¢ Parasitic diseases are highly prevalent in sheep and goat in District Bannu..
¢ External and internal parasites have significant effect on blood parameters.
Methodology and Results
During this study period 500 sheep and 500 goats were examined for endo and ectoparasites while using various fecal tests such as using direct microscopic examination, simple test tube flotation method and sedimentation method for endoparasites. Out of 500 goats and 500 sheep, 47 goats and 63 sheep were found positive for ectoparasites and percentage ratio was 9.4% in goats and 12.6% in sheep. Mostly, three types of ectoparasites were observed in both of cases i.e. goats and sheep (ticks, lice and mites). The total no. of positive cases found for ectoparasites in goats were 244 (ticks 10.2%, lice 30.4% and mites 8.2% in district Bannu). This result indicates a significant load of ectoparasites in this area of the country. Out of 149 positive cases of ecto-parasites in sheep; tick infection was 7.8% (39/500), lice 15.2% (76/500) and mite infection was 6.8% (34/500). Fecal samples of all 1000 animals were analyzed for the presence of endoparasites, out of which 90.6% goats and 87.4% sheep were found positive for endoparasites. Overall goats were more likely to be positive for Haemonchus Spp. and almost 50.2% (251/500) animals were found positive. The prevalence of other endo-parasites like Trichurus 5.6% (28/500), Strongyloid 4% (20/500), Coccidia 8.6% (43/500), Fasciola 12% (60/500) and Trichostrongyloide were 10.2% (51/500) while in case of sheep Haemonchus Spp. positivity was 33.2% (166/500). The prevalence of other Endo-parasites like Trichurus 6.8% (34/500), Strongyloid 2.4% (12/500), Coccidia 6.8% (34/500), Fasciola 10.6% (53/500) and Trichostrongyloide were 13.6% (68/500). The hematological profile of infected animals indicates high TLC and low hemoglobin level.
Conclusion
It is concluded that high prevalence was due to poor management and lack of knowledge about feeding, vaccination, hygienic conditions and lack of proper deworming programme. To overcome the problem it was necessary to educate the farmers about deworming programme and proper use of insecticides.
Availability: Items available for loan: UVAS Library [Call number: 1593,T] (1).
8.
Identification Of Ticks And Tick-Borne Hemo-Parasitic Diseases Along With Therapeutic Trial Of Tick Infestation
by Sadaqat Ali | Dr. Muhammad Ijaz | Dr. Aneela Zameer Durrani | Prof. Dr. Azhar.
Material type: ; Format:
print
; Literary form:
not fiction
Publisher: 2013Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 1601,T] (1).
9.
Prevalence And Chemotherapy Of Anaplasmosis In Clinically Affected Small Ruminants Of Distric Lahore.
by Akhtar Ali | Dr. Muhammad Ijaz | Dr. Aneela Zameer Durrani | Prof. Dr. Azhar.
Material type: ; Format:
print
Publisher: 2013Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 1610,T] (1).
10.
Srudy Of Mycotoxicosis In Cattle And Buffalo In District Sheikhupura, Punjab.
by Salman Arshad | Dr. Aneela Zameer Durrani | Dr. Muhammad Hassan Saleem | Ms. Sehrish.
Material type: ; Format:
print
; Literary form:
drama
Publisher: 2013Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 1618,T] (1).
11.
Identification Of Ticks And Tick Bornehemoparasitic Diseases In Equines Of District Lahore.
by Khadija Javed | Dr. Muhammad Ijaz | Dr. Aneela Zameer Durrani | Prof. Dr. Azhar.
Material type: ; Format:
print
; Literary form:
not fiction
Publisher: 2013Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 1651,T] (1).
12.
Comparision of the Efficacy of Different Anti-Fungal in Ear Canal Infections of Dogs in Lahore and Its Suburbs, Pakistan.
by Sehrish Khan | Dr. Aneela Zameer Durrani | Dr. Asim IKhalid Mehmood.
Material type: ; Format:
print
Publisher: 2013Dissertation note: The present project was designed to study the presence and importance of
M. pachyderma infection in otitis externa in domestic dogs and to compare the efficacy of clotrimazole and nystatin, in district Lahore, Pakistan as no such previous reference is available. Random samples were collected for a period of three months, from the Government and private pet clinics. The targeted population was pet dogs of different age, sex and breeds. Samples were collected from all the dogs suffering from otitis externa brought to the clinics. The positive animals for M. pachyderma were divided into two groups, i.e. A and B, and treated with clotrimazole and nystatin respectively. A total of 200 cases of otitis externa were recorded and a prevalence of 23% of otitis externa with M. pachyderma infection were found positive.
In the present study, a non-significant difference (P>0.05) was observed between pendulous ear and erected ear dogs and no sex predilection was observed (P>0.05). However, a higher prevelance (86.90%) was recorded in dogs more than one years of age group. In the present investigation, clotrimazole showed higher efficacy (P < 0.05) with the significant reduction of yeast population and clinical signs of otitis.
Availability: Items available for loan: UVAS Library [Call number: 1693,T] (1).
13.
Assessing The Efficacy Of Aqueous Garlic Extract Against Cyanide Toxicity In Mice Using Righting Reflex Recovery
by Sajid Ali | Dr. Muhammad Avais | Dr. Aneela Zameer Durrani | Prof. Dr.
Material type: ; Format:
print
; Literary form:
not fiction
Publisher: 2013Dissertation note: The KCN intake has been linked to central nervous system (CNS) syndromes and thyroid in animals as well as humans. It is very potent toxin even at very narrow dose ranges. Prolonged KCN exposure has also been associated with reduced growth rate in animals, disturbance in thyroid metabolism, lesions in liver, kidneys, lungs and also CNS pathology.
Male mice weighting about 20-40 grams were purchased from Veterinary Research Institute, Lahore, National Institute of Health, Islamabad, Animal house, University of Veterinary and Animal Sciences, Lahore and divided into 30 treatment groups. After acclimatization of mice, carefully, the mice were grouped as follows:
Control group
A group of 6 mice were treated with potassium cyanide (KCN) intra-peritoneally at 5.5mg/kg that induced a knock down state with recovery period of approximately 1 hour. Prior to each experiment, three or more mice were treated with KCN at this dose to verify that the recovery time was close to 1 hour.
Potassium Cyanide (KCN) + Aqueous Garlic Extract (AGE) at 250 mg/kg: Group 1 (5-min pre-KCN)
A group of 6 mice was given AGE intraperitoneally (i.p) at 250 mg/kg. After 5 minutes of AGE injection, an i.p. injection of KCN at 5.5 mg/kg was given and righting reflex recovery time was recorded.
Potassium Cyanide (KCN) + Aqueous Garlic Extract (AGE) at 250 mg/kg: Group 2 (5-min post-KCN)
A group of 6 mice was administered with KCN intraperitoneally (i.p) at 5.5 mg/kg. After 5 minutes of KCN injection, each mouse was treated with AGE at 250 mg/kg i.p. and righting reflex recovery time was noted.
Potassium Cyanide (KCN) + Aqueous Garlic Extract (AGE) at 500 mg/kg: Group 3 (5-min pre-KCN)
A group of 6 mice was given AGE intraperitoneally (i.p) at 500 mg/kg BW. After 5 minutes of AGE injection, an i.p. injection of KCN at 5.5 mg/kg was given and righting reflex recovery time was recorded.
Potassium Cyanide (KCN) + Aqueous Garlic Extract (AGE) at 500 mg/kg: Group 4 (5-min post-KCN)
A group of 6 mice was administered with KCN intraperitoneally (i.p) at 5.5 mg/kg. After 5 minutes of KCN injection, each mouse was treated with AGE at 500 mg/kg i.p. and righting reflex recovery time was recorded.
Potassium Cyanide (KCN) + Aqueous Garlic Extract (AGE) at 750 mg/kg: Group 5 (5-min pre-KCN)
A group of 6 mice was treated with AGE intraperitoneally (i.p) at 750 mg/kg. After 5 minutes of AGE injection, an i.p. injection of KCN at 5.5 mg/kg was given and righting reflex recovery time was recorded.
Potassium Cyanide (KCN) + Aqueous Garlic Extract (AGE) at 750 mg/kg: Group 6 (5-min post-KCN)
A group of 6 mice was administered with KCN intraperitoneally (i.p) at 5.5 mg/kg. After 5 minutes of KCN injection, each mouse was treated with AGE at 750 mg/kg i.p. and righting reflex recovery time was recorded.
Potassium Cyanide (KCN) + Aqueous Garlic Extract (AGE) at 250 mg/kg: Group 7 (30-min post-KCN)
One more group of 6 mice was given AGE at 250 mg/kg orally. After 30 minutes of AGE administration, an intraperitoneal (i.p) injection of KCN at 5.5 mg/kg was given and righting refelx recovery time was noted.
Potassium Cyanide (KCN) + Aqueous Garlic Extract (AGE) at 500 mg/kg: Group 8 (30-min post-KCN)
A group 6 mice was given AGE at 500 mg/kg orally. After 30 minutes of AGE administration, an intraperitoneal (i.p) injection of KCN at 5.5 mg/kg was given and righting reflex recovery time was noted.
Potassium Cyanide (KCN) + Aqueous Garlic Extract (AGE) at 750 mg/kg: Group 9 (30-min post-KCN)
One more group of 6 mice was given AGE at 750 mg/kg orally. After 30 minutes of AGE administration, an intraperitoneal (i.p) injection of KCN at 5.5 mg/kg was given and righting reflex recovery time was recorded.
Garlic Extract Group: (Group 10-15)
Three groups 10 - 12 each with 6 mice were injected intraperitoneally (i.p) with AGE at 250, 500 and 750 mg/kg respectively and righting reflex recovery time of each mouse in respective dose group was noted to observe any effects of AGE on righting reflex recovery time. Three groups 13 - 15 each with 6 mice were treated with AGE orally at 250, 500 and 750 mg/kg respectively and righting reflex recovery time of each mouse in respective dose group was noted to observe any effects of AGE on righting reflex recovery time.
Potassium Cyanide (KCN) + Sodium Nitrite (SN): Group 16 (5-min pre-KCN)
A group of 6 mice was given SN at 20 mg/kg intraperitoneally (i.p). After 5 minutes of SN injection, an i.p. injection of KCN at 5.5 mg/kg was given and righting reflex recovery time was recorded.
Potassium Cyanide (KCN) + Sodium Nitrite (SN): Group 17 (5-min post-KCN)
Another group of 6 mice was administered with KCN intraperitoneally (i.p) at 5.5 mg/kg. After 5 minutes of KCN injection, each mouse was treated with SN at 20 mg/kg i.p. and righting reflex recovery time was noted.
Potassium Cyanide (KCN) + Sodium Thiosulphate (ST): Group 18 (5-min pre-KCN)
A group of 6 mice was given ST at 600 mg/kg intraperitoneally (i.p). After 5 minutes of ST injection, an i.p. injection of KCN at 5.5 mg/kg was given and righting reflex recovery time was recorded.
Potassium Cyanide (KCN) + Sodium Thiosulphate (ST): Group 19 (5-min post-KCN)
A group of 6 mice was administered with KCN intraperitoneally (i.p) at 5.5 mg/kg. After 5 minutes of KCN injection, each mouse was treated with ST at 600 mg/kg i.p. and righting reflex recovery time was recorded.
Potassium Cyanide (KCN) + Sodium Nitrite (SN) & Sodium Thiosulphate (ST): Group 20 (5-min pre-KCN)
A group of 6 mice was given SN and ST at 20 mg/kg and 600 mg/kg intraperitoneally (i.p) respectively. After 5 minutes SN and ST injection, an i.p. injection of KCN at 5.5 mg/kg was given and righting reflex recovery time was recorded.
Potassium Cyanide (KCN) + Sodium Nitrite (SN) & Sodium Thiosulphate (ST): Group 21 (5-min post-KCN)
A group of 6 mice was administered with KCN intraperitoneally (i.p) at 5.5 mg/kg. After 5 minutes of KCN injection, each mouse was treated with SN and ST at 20 mg/kg and 600 mg/kg i.p. respectively and righting reflex recovery time was noted.
Potassium Cyanide (KCN) + Aqueous Garlic Extract (AGE) & Sodium Nitrite (SN): Group 22 (5-min pre-KCN)
A group of 6 mice was given AGE at 750 mg/kg and SN at 20mg/kg intraperitoneally (i.p). After 5 minutes of AGE and ST injection, an i.p. injection of KCN at 5.5 mg/kg was given and righting reflex recovery time was noted.
Potassium Cyanide (KCN) + Aqueous Garlic Extract (AGE) & Sodium Nitrite (SN): Group 23 (5-min post-KCN)
A group of 6 mice was administered with KCN intraperitoneally (i.p) at 5.5 mg/kg. After 5 minutes of KCN injection, each mouse was treated with AGE at 750 mg/kg and SN at 20 mg/kg i.p. and righting reflex recovery time was recorded.
Potassium Cyanide (KCN) + Aqueous Garlic Extract (AGE) & Sodium Thiosulphate (ST): Group 24 (5-min pre-KCN)
A group of 6 mice was given AGE at 750 mg/kg and ST at 600mg/kg intraperitoneally (i.p). After 5 minutes of AGE and ST injection, an i.p. injection of KCN at 5.5 mg/kg was given and righting reflex recovery time was recorded.
Potassium Cyanide (KCN) + Aqueous Garlic Extract (AGE) & Sodium Thiosulphate (ST): Group 25 (5-min post-KCN)
A group of 6 mice was administered with KCN intraperitoneally (i.p) at 5.5 mg/kg. After 5 minutes of KCN injection, each mouse will be treated with AGE at 750 mg/kg and ST at 600 mg/kg i.p. and righting reflex recovery time was noted.
Sodium Nitrite (SN) alone (Group 26)
6 mice in this group were treated with SN at 20 mg/kg intraperitoneally (i.p) and any effects on righting reflex recovery time were noted.
Sodium Thiosulphate (ST) alone (Group 27)
A group of 6 mice in group 27 were treated with ST at 600 mg/kg intraperitoneally (i.p) and any effects on righting reflex recovery time were noted.
Aqueous Garlic Extract (AGE) + Sodium Nitrite (SN) (Group 28)
The mice in group 28 were treated with AGE + SN at 750 mg/kg and 20 mg/kg intraperitoneally (i.p) respectively and righting reflex recovery time was noted.
Aqueous Garlic Extract (AGE) + Sodium Thiosulphate (ST) (Group 29)
A group of 6 mice in this group were treated with AGE at 750 mg/kg and ST at 600 mg/kg intraperitoneally (i.p) and righting reflex recovery time was recorded.
Sodium Nitrite (SN) + Sodium Thiosulphate (ST) (Group 30)
A group of 6 mice in group 30 were treated with SN and ST at 20 mg/kg and 600 mg/kg intraperitoneally (i.p) respectively and righting reflex recovery time was recorded.
The efficacy of the antidote estimated was based upon the reduction in righting reflex recovery time.
The righting reflex recovery time that was close to 1 hour was determined against KCN regimen. AGE was tested as potential antidote against sub-lethal KCN toxicity at dose regimens 250, 500 and 750 mg/kg intraperitoneally as well as orally at dose regimens 250, 500 and 750 mg/kg 5 minutes before and 5 minutes after KCN administration. SN and ST were tested at 20, and 600 mg/kg respectively as antidotes against sub-lethal KCN toxicity, 5 minutes before and 5 minutes after KCN administration. These were also tested in comparison and a dose with minimum recovery time was noted. A comparison was made between the efficacy of AGE and SN or ST or SN + ST as potential antidote against sub-lethal KCN toxicity. After 48 hours 3 mice from each group was sacrificed for postmortem examination.
For this purpose the righting reflex recovery time and survival data was collected for each mouse challenged with KCN. A group of 3 mice was tested with each increasing dose of KCN to create dose response curves for both righting reflex recovery times and percent survival. Increasing doses of KCN increased the recovery time of the righting reflex. The dose 5.5 mg/kg of KCN showed the righting reflex recocery time mean 64.66 ± .333 min and was selected for trials.
AGE (750 mg/kg) showed the most significant results as compared to ST and SN alone as well as in combination. Second most effective drug was ST as it showed better results than SN. Treatment results were more pronounced in 5 min pre-KCN groups as compared to 5 min post-KCN groups.
From this study it was concluded that the aqueous AGE is an effective antidote against sub-lethal KCN toxicity as the recovery times indicated that its effects are more pronounced than SN and ST, secondly, as it is easily available and very much cheaper in Pakistan and due to easy unavailability of SN and ST, it is effective antidote that could be used in the field against sub-lethal KCN toxicity with comparatively better results both orally and intraperitoneally.
Availability: Items available for loan: UVAS Library [Call number: 1776,T] (1).
14.
Levels Of Maternal Antibodies Against Pasteurella Multocida In New Born Buffalo Calves
by Muhammad Bilal | Dr. Aneela Zameer Durrani | Dr. Muhammad | Dr. Muhammad Ijaz.
Material type: ; Format:
print
Publisher: 2013Dissertation note: Buffalo is called black gold. The buffalo is raised for meat and milk purpose in Pakistan.The buffalo calves are at risk of many infectious diseases. One of the most important diseases is Hemorrhagic septicemia (HS). Hemorrhagic septicemia is caused by Pasturellamultocida important strains in Asia are B:2 and B:2.5. Buffalo calves are more suspected to the Hemorrhagic septicemia than adults one. In Pakistan the high prevalence of 49% is in the rainy season (Farooqet al. 2007)
Clinically the signs of Hemorrhagic septicemia includes profuse salivation,pyrexia, respiratory distress, swelling in throat, discharge through nostrils, protrusion of tongue, edema in the brisket area as well as in forelegs. Hemorrhagic septicemia can be diagnosed on the bases of clinical signs and laboratory conformation by Gram staining and. Serum agglutination test, Counter immune-electrophoresis and ELISA techniques are also used.Enrofloxacine was found to be effective treatment in case Hemorrhagic septicemia. Best protection measure vaccination by alum precipitated vaccine (Boudewijn et al. 2008).
During the present study blood samples were collected from the calves at different intervals of times. Serum was separated from that blood and was analyzed by using Indirect Haemagglutination(IHA) Test to observe the antibodies titer in the blood.The data was analyzed to calculate geometric mean titer (GMT) of the antibodies. Immunity status is much important in the defense of disease especially in the newly born claves which are more at risk of infections.The result of present study showed geometric mean titer 16 in colostrum of vaccinated dams and their newly born claves showed 0, 3. 4, 7 and 3 at 0 hour, 72 hour, 7, 15 and 30 days of their age. Colostrum of non-vaccinated dams showed GMT 8 and their newly born claves showed 0, 1. 3, 3 and 1 at 0 hour, 72 hour, 7, 15 and 30 days of their age.The maternal antibodies which are produce in the body of mother are transferred to their calves.The calves given birth by the vaccinated dams receive much higher level of antibodies from their mother than the calves born from non-vaccinated dams. This antibodies production in non-vaccinated dams is because of the carrier status of hemorrhagic septicemia.The non-vaccinated dams which are not expose to the any type of HS infection or not expose to the vaccines, they do not produce antibodies against Pasturellamultocidaand also not transfer to their young babies after birth.
The present study showed that claves of vaccinated dams are much protected in their early period of life against hemorrhagic septicemia. Buffalo calves need quick and intense care at early age and they need quick vaccinations.
The high maternal antibodies level against Pasturellamultocidain vaccinated dams then in non-vaccinated dams antibodies levels in newly born buffalo calves remain effective for longer period.
This study suggested for the vaccination of dams not only for the protection of themselves but also for the protection of their newly born claves at the crucial period of their young age.
Availability: Items available for loan: UVAS Library [Call number: 1807,T] (1).
15.
Clinico Bacteriological Investigation Of Mastitis Dairy Goats
by Muhammad Rizwan | Prof Dr Aneela Zameer Durrani | Dr Muhammad Ijaz | Dr Sehrish | Faculty of Veterinary Sciences.
Material type: ; Format:
print
; Literary form:
drama
Publisher: 2014Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 1862,T] (1).
16.
Comparative Potency Testing Of Oil Based Foot And Mouth Disease Caccines In Azakheli Buffaloes
by Asghar khan | Prof. Dr Aneela zameer durrani | Dr, Syed Sleem ahmad | Prof Dr Khushi.
Material type: ; Format:
print
; Literary form:
not fiction
Publisher: 2014Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 1870,T] (1).
17.
Prevalence And Chemotherapy Of Prevalence and Chemotherapy of Balantidium Coli in Sheep And Goats in And Around Lahore
by Mustafa jamil | Dr. Muhammad Ijaz | Prof. Dr. Aneela Zameer Durrani | Prof. Dr. Azhar.
Material type: ; Format:
print
; Literary form:
drama
Publisher: 2014Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 1885,T] (1).
18.
Prevalence And Intensity Of Haenonchosis In Small Ruminants In Lodhran Its Trearment And Effect On Hemogram and Serum Biochemistry
by Hafiz Muhammad Qasun | Dr.Muhammad Avais | Prof. Dr | Prof. Dr Aneela zameer durrani.
Material type: ; Format:
print
; Literary form:
not fiction
Publisher: 2014Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 1903,T] (1).
19.
Antibody Response Of Goats To Gel Based Combined Vaccine Against Peste Des Petits Ruminants Contagious Caprine
by Muhammad Khalil | Prof.Dr. Khushi Muhammad | Dr. Aneela Zameer Durrani | Dr.Jawad Nazir.
Material type: ; Format:
print
Publisher: 2014Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 1933,T] (1).
20.
Frozen Tectonic Corneal Grafting For Repair Of Perforating Corneal Ulcers In Dogs
by Abid Hussain | Dr. Asim khalid mehmood | Dr. Zia ullah | Prof. Dr. Aneela zameer durrani.
Material type: ; Format:
print
; Literary form:
not fiction
Publisher: 2014Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 2069,T] (1).
21.
Prevalence And Chemotherapy Of Fusobactemium Necrophorum In Dairy Cattle
by Haq Nawaz | Prof. Dr. Muhammad Sarwar Khan | Dr | Prof. Dr. Aneela Zameer Durrani.
Material type: ; Format:
print
; Literary form:
not fiction
Publisher: 2014Dissertation note: Abstract Availability: Items available for loan: UVAS Library [Call number: 2146,T] (1).
22.
Pathological Investigations Of Theileriosis (T.Annulata) In Cattle In Disteict Lahore Punjab
by Syed Sadeed ud din Shah | Dr. Muti-ur- Rehman Khan | Dr. Raheela Akhtar | Prof. Dr. Aneela Zameer Durrani.
Material type: ; Format:
print
; Literary form:
not fiction
Publisher: 2014Dissertation note: Theileriosis is very important protozoal disease in crossbred cattle. According to an
assessment, about 250 million cattle are endangered by this disease and millions of high milk
yielding cattle are at risk of exposure to disease. It acts as a bigger restraint on livestock
improvement and production in many developing countries (Nagore et al. 2004). Theileria
annulata is the main specie that causes high morbidity and mortality. It causes heavy economic
and production losses in cattle in tropical and sub-tropical regions. The recorded mortality rates
in cattle reached to 70% (Moor house et al. 2001).
Theileria species are intracellular obligate hemoprotozoan parasites. All Theileria species
are dangerous and cause disease but two of them are important for livestock. Theileria parva and
T. annulata produces diseases named as East Coast fever and tropical theileriosis in cattle
respectively. Genus Theileria has many other species like T. buffeli, T. taurotragi, T. velifera, T.
sergenti and T. mutans. These species cause infections in wild and domesticated ruminants.
Theileria species present in large and small animals show signs like fever, anorexia,
swelling of the superficial lymph nodes, dyspnoea, lethargy, progressive anemia, constipation,
diarrhea, lacrimation and nervous symptoms (Saeed et al. 2010; Irvin and Mawmachi 1983). A
pronounced rise in body temperature, reaching 40-41.5 °C is pursued by lacrimation, depression,
swelling of the superficial lymph node and nasal discharge. The characteristic sign of tropical
theileriosis is anemia and finally haemoglobinuria occur with heavy weight losses. The clinical
course of the disease alter from per acute to acute or sub-acute to chronic (Oliveira- Sequeira et
al. 2005). The disease is lymphoproliferative in its early phases resulting enlargement of lymph
nodes, later on enters lymph destructive phase which is associated with a pronounced
Introduction
2
leukopenia. In the piroplasms phase in erythrocytes, the parasite becomes infective for the tick
(El-Deeb and Younis 2009).
Trans placental Bovine Tropical Theileriosis causing a deadly disease in a 3 day old
neonate cross bred calf and cerebral form of the disease (turning sickness) in a cow were
incriminated to T.annulata infection. It mainly depends upon the harmful effects of the T.
annulata on lymphoid tissues and susceptibility of the host (Sudan et al. 2012).
Theileriosis is prevalent in various regions of the world including Pakistan. It is transmitted by
Hyalomma species ticks. These ticks spread T. annulata which causes tropical theileriosis
(Durrani et al. 2009). The developmental stages of Theileria inside the Hyalomma ticks varies in
different shapes and forms (Hamed et al. 2011). Therefore to increase the milk and meat
production of cattle we can prevent the spread of the disease by controlling ticks
(Hekmatimoghaddam et al. 2012). The sufficient amount of Hyalomma ticks are found in warm,
commonly hard marshland and in central and Southern Europe, south west Asia and Southern
Africa having very long dry season. A toxin is produced in the adult ticks. This toxin produce
clinical signs of mucus membrane hyperemic and moist profuse eczema (Adam et al. 2000).
The sporozoites of Theileria enter into cattle host during tick feeding and they
immediately infect mononuclear leukocytes, these sporozoites develop into macroschizonts and
induce proliferation of the host cells. Macroschizonts constantly mature into microschizonts and
finally into merozoites, which are discharged from leukocytes. These merozoites attack
erythrocytes and mature into piroplasms, become available to ticks. Infective sporozoites,
injected during tick feeding, rapidly enter target cells, escape from the surrounding host-cell
membrane and differentiate to schizonts that interact with different host-cell components
(Dobbelaereand Rottenberg 2003). This interaction includes host cell signaling pathways that
Introduction
3
regulate proliferation and cell survival (Chaussepied and Langsley 2011) and thus cause
blastogenesis and clonal expansion of predominantly T and B cells (Fawcett et al. 1982; Baldwin
et al. 1988; Spooner et al. 1989). Merozoites released from these schizonts subsequently infect
red blood cells and become trophozoites. Lymphocytic stage of Theileria (schizonts) is the cause
of many of the severe disease manifestations like lymphadenopathy, pyrexia, thrombocytopenia,
and panleukopenia (Homer et al. 2000). Marked anemia, anisocytosis, pikilocytosis, and
leucopenia were commonly observed in bovine theileriosis (Ceci et al. 1997). Cattle may survive
the disease, but recovery and convalescence may be protracted and incomplete, this leads to
permanent debilitation, loss of productivity and prolonged carrier state. (Shahnawaz et al. 2011).
Cattle with subclinical infection in endemic regions become carrier of piroplasms and act as a
source of infection for the vectors (Brown 1997; Brown 1990; Uilenberg 1995).
The diagnosis of theileriosis in acute cases is majorly done on clinical signs and Giemsa
stained blood smears of cattle but the detection of agent is not reliable and is almost impossible
in carrier stage. Advances in molecular biological techniques have resulted in the improved
detection, identification, and genetic characterization of many hemoparasites. Species specific
polymerase chain reaction (PCR) has been developed for the detection and identification of
various Theileria species and has been shown to have higher sensitivity and specificity compared
with serological assays and examination of Giemsa-stained blood smears (Bhoora et al. 2009).
Primers were derived from the gene encoding the 30-kDa major merozoite surface antigen for T.
annulata (Aktas et al. 2006).
Most of the previous studies on haematological parameters in T. annulata infection were
carried out on experimentally infected cattle (Sandhu et al. 1998; Singh et al. 2001). The present
investigation was conducted to study haematological parameters in cattle naturally infected with
Introduction
4
T. annulata. Hematology has been broadly used in attempts to give information about disease
condition, performance problems and health in cattle (Rezaei and Naghadeh. 2006).
Hematological and sero-biochemical alterations are the indicators of severity of disease and are
considered to be good tools for the diagnosis, prognosis for effective therapy (Col and Uslu
2007; Nazifi et al. 2010b).
Lahore is one of the larger district in the Punjab province of Pakistan. Different cattle
breeds are reared by the people of the area for meat and milk production. The exact current
situation about the prevalence and pathogenesis of Theileriosis in the selected area is unknown.
The present study was conducted to screen cattle by finding schizonts or piroplasms in Giemsa
stained thin blood smears at slaughter house of district Lahore (Aktas et al. 2006) and later to
confirm through Polymerase Chain Reaction (PCR) (Chaisi et al. 2013) in order to implement
efforts and regulation to eradicate the spread of disease in the selected area. Data generated from
this study provided the latest status of Theileriosis, sex wise prevalence and its pathogenesis in
cattle population of Lahore. The study has also provided the necessary information to formulate
strategies for control of disease in the area. An investigation was also undertaken to ascertain the
changes in haematology as a result of Theileria annulata infection. These studies will help better
understanding of the pathogenesis and supportive therapy of this disease. Availability: Items available for loan: UVAS Library [Call number: 2186,T] (1).
23.
Common Nosocomial Bacterial Isolation And Identification From Veterinary Hospitals
by Muhammad Umar Zafar Khan (2008-VA-255) | Prof. Dr. Aneela Zameer Durrani | Prof.Dr.Muhammad Sarwar Khan | Dr. Hassan Bin Aslam.
Material type: ; Literary form:
not fiction
Publisher: 2015Dissertation note: CD not available. Availability: Items available for loan: UVAS Library [Call number: 2217-T] (1).
24.
Safety Level And Efficacy Of Controlled Release Urea On Performance And Health Status Of Nili Ravi Buffalo
by Muhammad Mobin (2007-VA-156) | Prof. Dr. Aneela Zameer Durrani | Dr. Jawairia Ali Khan | Dr. Nisar Ahmad.
Material type: ; Literary form:
not fiction
Publisher: 2014Dissertation note: Livestock is one of the major sectors of Pakistan’s agrarian based economy. During 2013-14, it contributed almost 55.4% to the agricultural value added and 11.9% to national GDP. In the livestock sector, gross value addition increased from Rs.735 billion to Rs.756 billion; revealing an increase of 2.9% as compared to the previous year. Livestock is considered the best tool for poverty alleviation, as most of the livestock are owned by poor people who live in the rural areas. Pakistan is 4th largest Milk producing country in the World. Its Cattle Population is 33 Million while Buffalo Population is about 30 Million (Economic Survey of Pakistan, 2013-14). Despite large population, per animal production is very low.The low productivity of these animals is because of poor quality feed stuff. Their productivity can be enhanced by feeding them balanced ration.
Growing human population urges the intense need to explore the present livestock resources to fulfill the animal protein requirements. It is impossible unless optimal fodder and forage production is ensured. In Pakistan, low quality fodders coupled with the reduction in the fodder area are the main constraints, which adversely affect the animal production. In future, it is expected that ruminants will be more dependent on forages because readily expanding human population will have direct competition with livestock for edible grains.
Among the problems facing the livestock in the tropics is the low protein tropical grasses and the high cost of alternate sources of protein such as the Soybean and other oil cake. A portion of nitrogen in feeds for ruminants may be provided in the form of simple nitrogen compounds (or0non-protein0nitrogen0NPN) 0that are degraded in the0rumen to release ammonia (NH3), which is used by rumen microorganisms to produce amino acids. The amount of NPN that can be provided is limited. The product which is the urea, when it releases NH3 faster than it can be converted into microbial protein excess NH3is absorbed through the rumen wall, causing toxication.
Protein is often0the0major0limiting0nutrient for ruminants. Protein-rich leguminous forages and vegetable protein supplements are usually expensive or not available.The manufacture0of0urea and0ammonia for use as0fertilizer has been greatly0expanded in0many countries, 0but these compounds0could0not be0used more0widely in feeds for0ruminants. The ability0of0the0micro-organisms0in0the0rumen0of0cattle0and0sheep0to0utilize0urea0sources0to form0true protein0that0can0be converted0to meat0and0milk0by the0animals, represents0an important0contribution0to0man's0food0supply.0Maximizing0microbial0protein0synthesis0and flow0to0the0duodenum0by0reducing the0recycling of0microbial N in the rumen offers a potential0to improve0the production0efficiency0of ruminants.In general, the efficiency of utilization of dietary N by cattle is relatively low under normal production conditions (Castillo et al, 2001) with a global average N-efficiency in cattle estimated at 7.7 % (Van der Hoek, 1998). Urea is used rather inefficiently for production of protein products (Broderick et al, 2009) and due to its wide use in ruminant feeds, may0be0partially0responsible for0the poor N efficiency0in cattle. Low efficiency of utilization of dietary urea has been attributed to the rapid0hydrolysis0to0ammonia (NH3) in0the0rumen0by microbial0enzymes which occurs at a higher rate than its utilization byrumen bacteria, leading to ruminal accumulation and absorption0of0ammonia andsubsequent excretion of0urea in the urine (Golombeski0et0al., 2006; Highstreet0et0al,2010).Furthermore if used above threshold level, the main problem with urea usage is that it can cause toxicity and even death of the animals. Farmers hesitate to use urea as a source of protein, resulting which his animals remain underfed and never achieve the peak production.
Urea0poisoning0is0one0of0the0more0commonly0suspected0toxicities0of0cattle. Urea0is0used as0a source0of non-protein0nitrogen0in feed0supplements.In ruminants,0nitrogen0from0urea is released0in the0rumen as0ammonia0and0can0be0used0by0rumen0micro0flora0to0synthesize protein. This0protein0thenbecomesavailable0to0the0animal0through0the0normal0processes of digestion0and0absorption. However,if0 more0ureaisconsumed0than the rumen organisms can0metabolize, the0ammonia0is0absorbed0from0the0rumen0into0the0blood.Ruminal pHbecame alkaline due to the hydrolysis of urea to0ammonia (Buffalo Bulletin,2002). The ammoniaisthen0converted0back0to urea in0the liver and is0the0excreted by0the0kidneys. This0pathwaycan easily be0overwhelmed,0when excess0ammonia0and urea0circulate0in the blood,0causing0poisoning. Poisoningcanoccur0rapidly0from a few0minutes0to four0hours after0consumption. Suspect0urea0poisoning0if cattle are found0dead close to0the0supplement (H. Parkes et al. 2003).Slow release urea has been shown to affect ruminal fermentation characteristics.Most notably, slow release urea is intended to0reduce0the release rate0of NH3 within the0rumen. Most reports on controlled release urea have shown a reduction in ruminal NH3 concentration when measured (Cherdthonget al, 2011; Huntington etal, 2006b; Taylor- Edwards0et0al, 2009d). This is the reason why slow release urea presents a lower risk for ammonia toxicity than feed grade urea. Ruminal NH3 concentration is often related to ruminal pH, as the protonation of NH3 toNH4+ when ammonia from urea ionizes, can result in an increase in ruminalpH. Consequently, there are reports of higher ruminal pH for animals fed urea than those fed slow release urea (Cherdthongetal, 2011; Taylor-Edwards et al, 2009b)
Availability: Items available for loan: UVAS Library [Call number: 2216-T] (1).
25.
Effect of Estradiol Benzoate (EB) and Equine Chorionic Gonadotropin (eCG) on Ovarian Response and Conception Rate in Control Internal Drug Release (CIDR) Based Estrus Synchronization Protocol in Nili Ravi Buffalo
by Abdul Saboor Khan (2008-VA-116) | Prof. Dr.Nasim Ahmad | Prof.Dr. Mian Abdul Sattar | Prof. Dr. Aneela Zameer Durrani.
Material type: ; Literary form:
not fiction
Publisher: 2015Dissertation note: Blank CD. Availability: Items available for loan: UVAS Library [Call number: 2239-T] (1).
26.
Comparative Efficacy Of Anthelmintics Against Gastrointestinal Nematodes In African Lion (Panthera Leo)
by Muhammad Usman Munir (2008-VA-141) | Dr. Aneela Zameer Durrani | Dr. Muhammad ijaz.
Material type: ; Literary form:
not fiction
Publisher: 2015Dissertation note: This study was conducted to compare the efficacy of Zental ( Albandazole) and Vermox (Mebandazole) against gastrointestinal nematodes like toxocara canis, toxocara mystax and toxascaris leonina in captive african lion (Panthera leo) kept in Lahore zoo, Lahor zoo safari, Bahawalpur zoo and Zain wildlife breeding farm Lahore because captive African lions are prone to different parasitic infestations.
A survey was carried out to estimate the prevalence of gastrointestinal nematodes in captive African lion and it was found that toxocara canis, toxocara mystax and toxascara leonina are the most commonly prevailing gastrointestinal nematodes in captive African lions in above mentioned places. The overall incidence rate of toxocara canis was 82.5 %, of toxocara mystax was 60% and of toxocara leonina was 50% respectively.
The Anthelmintics trials were conducted on 14 animals which were divided into 2 groups A and B each having 7 animals.
Group A was treated with Zental (Albandazole), group B was treated with Vormox (mebendazole), The percentage efficacy of each drug was determined on the basis of reduction on number of eggs per gram of discharged in faeces at day 7, 10, 13, 16 and 22 after deworming.
In group A, decrease in EPG of toxocara canis in group A was 21.1% at day 7, 37.2% at day 10, 54.7% at day 13, 74.6% at day 16 and 88.8% at day 22. Decrease in EPG of toxocara mystax was 15.9% at day 7, 38.1% at day 10, 56.6% at day 13, 70.6% at day 16 and 82.7% at day 22.similarly decrease in EPG on toxocaris leonina was 15.6% at day 7, 29.2% at day 10, 45.6% at day 13, 61.1% at day 16 and 83.1% at day 22 respectively
In group B, decrease in EPG of toxocara canis in group A was 7.24% at day 7, 14.57% at day 10, 23.26% at day 13, 31.27% at day 16 and 38.08% at day 22. Decrease in
Summary
25
EPG of toxocara mystax was 16.38% at day 7, 22.4% at day 10, 29.6% at day 13, 34.3% at day 16 and 41.2% at day 22.similarly decrease in EPG on toxocaris leonina was 13.6% at day 7, 21.29% at day 10, 30.8% at day 13, 39.1% at day 16 and 47% at day 22 respectively.
Results showed that efficacy of Zental (Albendazole) against gastrointestinal nematodes in African lion was higher as compared to that of Vermox (Mebendazole). Also it was more effective than Vermox (mebendazole) against different parasitic stages of nematodes as evident from EPG count at various days after medication. Availability: Items available for loan: UVAS Library [Call number: 2270-T] (1).
27.
Prevalence, Associated Risk Factors And Treatment Of Cryptosporidium Parvum In Foals
by Choudhry Usman Rasheed Butter (2008-VA-253) | Dr. Muhammad Avais | Prof. Dr. Aneela Zameer Durrani | Dr. Shakera Sadiq Gill.
Material type: ; Format:
print
; Literary form:
not fiction
Publisher: 2015Dissertation note: Cryptosporidium parvum is an emerging waterborne zoonotic disease prevalent
throughout the world. There are different strains of cryptosporidium but most important is
C.parvum.It is intestinal protozoon belongs to coccidian family that causes damage to intestinal
epithelium that leads to villous atrophy so decrease absorption sites from intestine. It is not host
specific it can equally infect humans, calves and foals. It is cross transmissible among mammals.
In horses, cryptosporidiosis is most commonly seen in foals (most frequently 1–4 weeks of age)
and is associated with diarrhea and weight loss. Immuno-compromised foals (including foals
with severe combined immunodeficiency syndrome) are particularly at risk. The present study
was conducted in different studs farms in and around Lahore keeping in view the importance of
C.parvum in foals because it is gaining attention as a most important cause of diarrhea in foals so
that effective therapeutic measures should be adopted to control infection. There are 323 samples
are collected among different stud farms and veterinary hospitals and analyzed by using fecal
floatation method and modified Ziehl-neelsen technique. Infection rate of C. parvum in foals in
this study recorded was (12.30%) from different stud farms and veterinary hospitals. Infection
rate (27%) is higher in foals of age group range between 1day to 3 months while the least
infection rate (2.46%) was observed in 9-12 months age group. Infection rate is reciprocal to age
as the age increase infection rate decrease. Infection rate is independent of sex. There is no
relationship between sex and infection rate. Diarrhea is an important risk factor related to
infection rate. In diarrheic foals infection rate is (22.5%) while in case of non-diarrheic foal’s
infection rate is (6.5%) which showed that infection rate in diarrheic foals is three time more as
Summary
36
Compared to non-diarrheic foals. A significantly higher infection rate was observed in those
foals having contact with other animals like rodents, ruminants and dogs. Infection rate (15%)
was observed in those foals having contact with other animals and infection rate (6.5%) observed
in foals having no contact with other animals. Purpose seems to very important in this study.
Game horses have more infection rate which was (15.45%) as compared to draught horses
(4.4%). Game horses have three times more infection as compared to draught horses because
game horses remain in close confinement and foals have more prone to infection. Management is
an important factor infection rate was more in those stud farms having poor management as
compared to those have good management. Infection rate is poorly manage farms was (20.97%)
and (5.5%) in properly manage farms. The results of the comparative efficacy of nitazoxanide,
furazolidone and garlic showed that the Nitazoxanide was the most effective of the three in
treating cryptosporidium infection under field conditions. Efficacy of Nitazoxanide in treating
C.parvum in foals was (88%) during the study followed by furazolidone which have comparative
efficacy of (77%) than garlic with the efficacy of (70%).
In conclusion from above discussion reveals that C. parvum is prevalent in stud
farms in and around Lahore. Associated risk for C. parvum in foals are age less than 6 months,
immune-deficiency, contact with other animals like ruminants and poor management. Infection
rate is more in game horses as compared to draught horses because game horses are manage in
close confinement so the chances of infection are more. Treatment of C.parvum has long course
and effective drug for the treatment of cryptosporidiosis in foals is Nitaoxanide than
furazolidone. Availability: Items available for loan: UVAS Library [Call number: 2300-T] (1).
28.
Effect Of Different Treatment Trials On The Carrier Status Of Streptococcus Equi In Horses Recently Recovered From Strangles
by Muhammad Afzal (2007-VA-108) | Dr. Muhammad Hassan Saleem | Prof. Dr. Aneela Zameer Durrani | Dr. Hassaan Bin Aslam.
Material type: ; Format:
print
; Literary form:
not fiction
Publisher: 2015Dissertation note: Strangles is characterized by upper respiratory tract infection, dysponea, anorexia, regional suppurative lymphadenitis causing high morbidity and low mortality in horses as well as in mules and it is an infectious problem of equine. Considering the significance and utilization of equines in our country and the substantial losses rendered by Strangles, the present project was designed to study epidemiology, diagnosis and chemotherapy of strangles in Lahore, Okara and Sargodha districts of the Punjab province in Pakistan. Streptococcus equi subspecies equi is highly prevalent in animals recently recovered from strangles and antibiotics along with immune stimulants and non steroidal anti-inflammatory drug became helpful in the elimination of carrier status of animals for S. equi. Samples were collected from animals recently recovered from Strangles. Samples were collected with the help of sterile cotton swabs dipped in normal saline from nasopharynx & oropharynx followed by culturing of samples on blood agar plates which were incubated anaerobically for a time period of 24-48 hours respectively and S. equi were isolated on the basis of colonies characteristics and growth pattern. Streptococcus equi was confirmed with the help of Gram staining and biochemical tests Catalase reaction, Methylene blue reduction test and Sugar fermentation test. In vitro antibiotic sensitivity test were also performed to select three antibiotics showing best efficacy against S. equi. Carrier animals were subjected to treatment with the help of antibiotic along with combination of immune stimulants and non steroidal anti-inflammatory drug. Carrier status was considered eliminated with disappearance of S. equi from nasopharynx. Blood samples were collected from carrier as well as from healthy animals to check out hematological parameters such as TLC (total leukocytes count), TEC (total erythrocytes count) and MHC (mean hemoglobin concentration) etc. Out of
Summary
47
hundred samples collected from Sargodha, Lahore and Okara districts of Punjab the prevalence of S. equi in horses and mules was 15%. Highest prevalence in equines was found at Remount Depot Mona, was recorded which is 18.3% followed by Okara 13.33%. No case was found to be positive for Strangles out of ten samples collected at UVAS, Lahore.
In-vitro antibiotic sensitivity test was performed on above isolates and it was found that ceftiofur Na was found to be most effective drug followed by norfloxacine and ampicillin. In vivo treatment trials showed that Group C animals treated with ceftiofur Na, norfloxacine, and ampicillin along with Vit E & Selenium supplemented by Phenyl butazone were found to be negative for post treatment carrier status. This study had aided in diagnosis as well as in treatment of strangles and was also provided us with the understanding of hematological parameters.
Statistical analysis:
Data on prevalence of S. equi in carrier animals were analyzed by Chi square test.
While comparison of different treatments trials was done by Z test.
Hematological parameters were analyzed by mean ± SED using SPSS software 16.0. Availability: Items available for loan: UVAS Library [Call number: 2299-T] (1).
29.
Effect Of L-Cysteine And Glutathione On Post Thaw Quality Of Sahiwal Bull Spermatozoa
by Farhan Younas (2007-VA-495) | Prof. Dr. Mian Abdul Sattar | Dr. Syed Murtaza Hasan Andrabi | Prof. Dr. Nasim Ahmad | Prof. Dr. Aneela Zameer Durrani.
Material type: ; Format:
print
; Literary form:
not fiction
Publisher: 2015Dissertation note: Freezing and thawing of semen leads to production of reactive oxygen species (ROS)
due to plasma membrane lipid peroxidation. Because of this semen quality can be
compromised. To overcome this problem, antioxidants have been used in cryopreservation
medium. Glutathione and cysteine have thiol groups which penetrate into the cell and protect
it from oxidative stress. In this study, effect of different concentrations of cysteine and
glutathione on post thaw quality of Sahiwal bull spermatozoa was determined.
Semen was collected with artificial vagina from five mature regular donor Sahiwal
bulls kept at the Semen Production Unit Qadirabad, Sahiwal. Semen samples possessing
>60% motility and >500x10
6
sperm/ml were included in study. After collection, semen
samples from five bulls were pooled, divided into seven equal aliquots and kept at 37 ºC in
water bath. After that dilution was done with Tris citric egg yolk extender having different
concentrations of cysteine and glutathione as Con (0.0 mM), C1 (1.0 mM cystein), G1 (1.0
mM glutathione), CG0.5/1(0.5 mM Cysteine+1.0 mM glutathione), CG1/0.5 (1.0 mM
cysteine+0.5 mM Glutathione), CG0.5/0.5 (0.5 mM cysteine+0.5 mM glutathione) and
CG1/1 (1.0 mM cysteine+1.0 mM glutathione). Diluted samples were cooled to 4ºC in two
hours and equilibrated for 4 hours at 4
o
C. After that they were packaged into 0.5 ml French
semen straws (20x10
6
sperm/straw). All semen straws were placed 4cm above liquid nitrogen
surface in vapors for 10 minutes. Then, semen straws were plunged into liquid nitrogen for
freezing and stored until post thaw analysis. The experiment was repeated for five times
(replicates = 5). Four semen straws/treatment were thawed for 30 seconds in water bath at
37ºC and evaluated for visual motility, plasma membrane integrity (PMI), acrosome integrity,
mitochondrial trans membrane potential and CASA motility parameters and kinematics.
42
Summary
PMI in group CG0.5/0.5 was significantly higher (40.00±1.42 %) as compared to Con
26.67±0.80 (P<0.5). Plasma membrane integrity in groups CG1/1, CG0.5/1, G1 and C1 was
significantly higher (36.00±1.88 %, 36.20±1.07 %, 33.60±1.21 % and 32.80±0.80 %
respectively) as compared to Con (26.67±0.80 %) (P<0.05). There was no significant
difference in C1 (32.80±0.80 %) and G1 (33.60±1.21 %) (P>0.05). In case of acrosome
integrity, NAR value of group CG0.5/0.5 was significantly higher (71.40±1.08 %) as
compared to Con (59.67±0.37 %) (P<0.05). All other groups also showed significant
differences as compared to Con (P<0.05). CG0.5/0.5 also showed significantly higher NAR
value (71.40±1.08 %) as compared to C1 (64.40±1.40 %) and G1 (67.60±2.07 %) (P<0.05).
CG0.5/0.5 had significantly higher value (71.40±1.08 %) as compared to CG1/0.5 and CG1/1
(65.60±0.81 % and 68.80±0.97 % respectively) (P<0.05). CG0.5/0.5 had significantly higher
subjective motility (54.00±1.88) as compared to Con (36.66±0.92)
Mitochondrial transmembrane potential of CG0.5/0.5 was significantly higher
(37.00±0.71 %) as compared to Con (25.33±1.28 %) (P<0.05). All the other treatment groups
also had higher mitochondrial transmembrane potential as compared to Con (P<0.05). In
groups of combination of cysteine and glutathione, CG0.5/0.5 showed significant difference
(37.00±0.71 %) as compared to CG1/1 and CG1/0.5 (29.00±1.00 % and 33.80±0.86 %)
respectively (P<0.05).
CASA results showed that CG1/1 had significantly higher motility as compared to the
control. But the percentage of progressive spermatozoa was significantly higher in
CG0.5/0.5. VSL of group CG0.5/0.5 was significantly higher (53.33±2.90 %) as compared to
Con (45.10±0.50 %). However, VSL, VCL, ALH and BCF did not vary significantly among
groups. STR and LIN of group CG0.5/0.5 were significantly higher as compared to the
control group.
43
Summary
In conclusion, addition of cysteine and glutathione in tris citric egg yolk extender
improved the post thaw quality of Sahiwal bull spermatozoa. In case of additive effect of
cysteine and glutathione, CG0.5/0.5 showed higher plasma membrane integrity, acrosome
integrity, mitochondrial transmembrane potential, progressive and rapid spermatozoa as
compared to CG0.5/1, CG1/0.5 and CG1/1.
44 Availability: Items available for loan: UVAS Library [Call number: 2318-T] (1).
30.
Prevalance, Diagnosis and Economic Losses Due to Bovine Cysticercosis in Punjab
by Muhammad saeed (2009-VA-254) | Prof. Dr. Aneela Zameer Durrani | Prof. Dr. Muhammad Arif Khan | Prof. Dr. Azhar Maqbool.
Material type: ; Literary form:
not fiction
Publisher: 2014Dissertation note: Theses submitted with blank cd. Availability: Items available for loan: UVAS Library [Call number: 1379-T] (1).
31.
Comparison Of Two Imported Live Attenuated PPR Vaccines In Local Sheep In Pakistan
by Saliha Saba | Prof. Dr. Aneela Zameer Durrani | Dr. Hassan Salem | Dr. Imran Altaf.
Material type: ; Literary form:
not fiction
Publisher: 2015Dissertation note: Peste des petits ruminants (PPR) also famous as goat plaque is of viral origin and is extremely contagious disease of sheep and goat (Dhar et al. 2002; Asim et al. 2009). PPR can cause high mortality about 50 – 80 % in non-immunized sheep and goat population. Due to its similarity with other diseases, Peste des petits ruminants (PPR) is being devalued but at the same time it is said to be one of the major constraints to successful small ruminant farming in tropics (Sen et al. 2010). PPR virus is paramyxovirus, enveloped and belongs to the genus morbillivirus. These viruses comprise of 16Kb long, single stranded RNA showing negative polarity (Barrett et al. 2005).
The various vaccines like homologous and recombinant vaccines have been manufactured for the management of Peste des petits ruminants (PPR), as no accurate treatment is available for its control. For the immunity of animals against this disease, the tissue culture based, attenuated rinderpest vaccine (TCRV) had been accustomed over a extensive period because of the antigenic association among RPV and PPRV (Diallo et al. 1989).With the help of fresh freeze-drying methods and stabilizing agents the thermostability of the present PPR homologous vaccine has been enhanced significantly (Worrwall et al. 2001).
In Pakistan, PPR vaccine was manufactured with the help of PPRV Nigerian 75/I (PPR 75/1 LK 6 Vero 75) for the sheep and goat immunization (Asim et al. 2009). India had manufactured numerous live attenuated vaccines like the PPRV Sungri/96 that has been regularized for use (Hegde et al. 2008). ). The Peste des Petits Ruminants (PPRV-Sungri/96 ) vaccine is being manufactured on small and large scale for prevention of Peste des Petits Ruminants (PPR) outbreaks in India (Singh et al. 2004).
Summary
41
The current study was designed to study the immunogenicity of two imported live attenuated PPR vaccines in local sheep. A total of sixty (60) animals were selected and further separated into two groups, viz. Group-A and Group-B, having thirty (30) animals each. Group-A was further sub-divided into A1 comprising 10 sheep to which Raksha PPR vaccine (Sungri 96) was administered, A2 comprising of 10 sheep to which PPR vaccine (Nigeria 75/1) was administered and A3 comprising of 10 non-vaccinated sheep which served as control. Group B was separated into two sub-groups i.e B1 and B2 having fifteen (15) animals each. The Group-B1 was sub-divided into B1a having 05 sheep to which Raksha PPR vaccine (Sungri 96) was only administered, B1b having 05 sheep to which along with Raksha PPR vaccine (Sungri 96), Vitamin AD3E was administered and B1c having 05 unvaccinated sheep which served as control.
Similarly the Group-B2 was sub-divided into B2a having 05 sheep to which PPR vaccine (Nigeria 75/1) was only administered, B2b having 05 sheep to which along with PPR vaccine (Nigeria 75/1), Vitamin AD3E was administered and B2c having 05 non-vaccinated sheep and served as control group respectively. The serum samples were collected and mean antibody titer was calculated by complement fixation test (CFT) at zero day, 7th day, 14th day, 28th day and 48th day post-vaccination.
The live attenuated, Raksha PPR (Sungri 96) vaccine induced the mean antibody titers of 0 ±0.00, 4.7±0.48, 4.7±0.48, 4.9±0.31 and 4.9±0.31 which was significantly higher than the mean antibody titers shown by the PPR (Nigeria 75/1) vaccinated animals i.e. 0±0.00, 3.3±0.51, 3.4±0.51, 4±1.15 and 4.1±1.19 at zero, 7th, 14th, 28th, 48th day post-vaccination respectively. Similarly the mean antibody titers shown by the PPR (Nigeria 75/1) vaccinated animals were 0 ±0.00, 10.4± 3.86, 11.2±4.13, 20±11.31 and 21.6±11.80 at zero, 7th,14th, 28th and 48th day post vaccination respectively. Result of present study demonstrated
Summary
42
that the mean antibody titer values of animals vaccinated with Raksha PPR (Sungri 96) was significantly higher than animals vaccinated with PPR (Nigeria 75/1) at zero, 7th,14th, 28th and 48th day post vaccination respectively. The study also concluded that the mean antibody titer of animals receiving vaccination along with vitamin supplementation was significantly higher than animals receiving only vaccination. While performing the statistical analysis of data, it was revealed that the results were significant (p<0.05).
The present study summarized and concluded that the mean antibody titer values of Raksha PPR (Sungri 96) was significantly higher than PPR vaccine (Nigeria 75/1). As both India and Pakistan are two neighbouring countries, so PPR among them also falls in trans-boundary disease category. It signifies that both being part of Asia subcontinent and PPRV strain of lineage IV prevails in both regions. Keeping these factors under consideration proper vaccination strategy should be followed for the immunization of animals. In past, Nigeria 75/1 strain of PPRV vaccine had been used in Pakistan but the results were not reliable in terms of desired immune response and protection. Although titer was shown by this vaccine but protection is not reliable for proper health care of small ruminants. There was an immense need to come up with the authentic research on PPRV vaccine Raksha PPR (Sungri 96) in Pakistan which is already being used in India with desirable results.
The results of present research project were mostly similar with the findings of other scientists. The results of this study were analyzed through Independent t-test for independent samples. Availability: Items available for loan: UVAS Library [Call number: 2385-T] (1).
32.
Seroprevalence And Molecular Detection Of Brucellosis In Animals In Mirpur, Azad Kashmir Pakistan
by Hadia Mubeen (2008-VA-291) | Dr. Muhammad Hassan Saleem | Dr. Iahtasham Khan | Prof. Dr. Aneela Zameer Durrani | Dr. Hassan Bin Aslam.
Material type: ; Literary form:
not fiction
Publisher: 2015Dissertation note: Brucellosis is declared as one of the most widespread zoonoses in the world by the world's reknowned organizations. It is defined as a contagious systemic bacterial disease primarily of ruminants. The disease is manifested by late term abortions, weak calves, still births, infertility and also associated placentitis, epididymitis and orchitis, with excretion of the organisms in uterine discharges and milk. With the intensification of the import of animals and the establishment of big farms in the last few years, the incidence of brucellosis increased sharply in many countries, both in man and animals.
In this study 360 serum samples were examined from four groups of animals in district Mirpur Azad Kashmir. Blood samples of 3ml from buffaloes, cattle, sheep and goat (n=30) each were taken from three sub-divisions of Mirpur separately. The serum samples were screened by RBPT which is a screening test for brucellosis, and it was observed that 8.6% animals were seropositive by RBPT. The serum samples of cattle were 17.8%, buffalo were 8.9%, goat were 2.2%, and sheep were 5.6% positive respectively.
The serum samples positive by RBPT and some randomly taken samples were further confirmed by the use of most specific and sensitive serological test known as i-ELISA. 6.87% animals were confirmed as seropositive by i-ELISA including cattle (17.5%), buffalo (10%), sheep (0%) and goat (0%).
All RBPT positive samples were further subjected to RT-PCR. Among these 31 samples 24 were positive for Brucella genus and only 7 samples were negative. Samples were further tested for confirmation of Brucella species. All 24 samples were having Brucella abortus.
The data were analyzed by using the Statistical package for the social sciences (SPSS) program version 22. Data were analyzed using Chi-square test and Z-test statistics. Availability: Items available for loan: UVAS Library [Call number: 2378-T] (1).
33.
Experimental Treatment Of Bovine Brucellosis Using Phyto-Chemo-Immuno Theraputic Agents
by Muhammad Kaleem (2013-VA-860) | Prof. Dr. Aneela Zameer Durrani | Dr. Ihtisham Khan | Dr. Muhammad Hassan Saleem | Prof. Dr. Khushi Muhammad.
Material type: ; Literary form:
not fiction
Publisher: 2015Dissertation note: Bovine brucellosis is very important zoonotic disease in respect of outbreak that resulted in reproductive loses through storm of abortions in herds and infertility in bulls. Currently, no phyto treatment for complete recovery from brucellosis is available.
Phyto Chemo-immune therapeutic agents are effective for recovery from bovine brucellosis (Hypothesis)
Group A was comprise five adult cows (n=5) positive for brucellosis. Animals in this group were given 3 shots of Oxytetracycline LA at 20mg/kg BW (IM) repeated every 48 hrs. Streptomycin @ 13mg/kg BW IM was given for six consecutive days. Furthermore, flunixin meglumine @ 2mg/kg BW IM for 3 days in combination with antibiotic. Selevit injection containing selenium and vitamin E was administered (IM) for consecutive five days. At next day all the animals in this group were vaccinated with a combined vaccine of RB51 and FMD (Oil based) at a dose of 3mL/animal through deep IM route. In group B, all the animals were given Saafi (Herbal Product) orally consecutively for six days. Furthermore, flunixin meglumin @ 2 mg/kg BW IM was administered for three days. All these treatments were given simultaneously. Then injection Selevit containing selenium and vitamin E were administered (IM) for consecutive five days. After treatment all animals were vaccinated with RB51 + FMD (oil based) 3mL/ animals deep intramuscularly. In group C, flunixin meglumin @ 2 mg/kg BW IM was administered for three days. After NSAID, Selevit injection containing vit. E and selenium was administered (IM) for five days regularly. After treatment, animals were vaccinated with RB51 + FMD (oil based) 3 mL/ animals (IM). In D group five negative adult animals were included in this group and vaccinated subcutaneously with RB51 and FMD (Oil based) at a dose of 3 mL/animal.
Summary
40
Data regarding this study was analyzed with ANOVA and completely randomized design was used to compare the mean between different groups using statistical package for social science (SPSS) version 20. P < 0.05 was considered significant.
The results showed OD values after 1st, 3rd and 6th month were significantly different in all groups. The mean values depicted that OD values was significantly higher (2.886±0.099) in vaccinated (positive) animal’s vs the other three groups. There was no significant difference in OD values of herbal treated, antibiotic treated and health control animals. The lowest OD values was found in healthy control animals, though significantly similar with herbal treated, antibiotic treated. The mean OD value at 3rd month after treatment is significantly higher (1.794±0.090) in herbal treated and vaccinated positive groups but the OD value of healthy group was lowest (1.794±0.090) after 3rd month of treatment. After 6th month of treatment the OD value of positive vaccinated group was found significantly highest (1.146±0.194). On the other hand lowest value (0.595±0.079) was found in healthy control group.
All the groups have found non-significant difference in all group. Regarding Real time PCR the value range from 0-40 Ct values. In the present study the Ct values of the control positive was found to be 13 which indicate control positive. The antibiotic treated group had a Ct value found in this range 35.61 to 38.13. The herbal treated group were all positive and the values were 31.34 to 37.42 Ct. The vaccinated immune booster group. The Ct values in the group was found to be 30.83 to 34.21. The birth weight and placenta dropping time was normal in antibiotic treated animals. There were no significant results found in all groups.
Summary
41
This study concluded that herbal regimen is effective in vitro against brucellosis but in vivo it is yet not to be evaluated. The antibiotics can be effective to treat the Brucellosis with this protocol. This was help to control bovine brucellosis, and extensive economic losses. Comparative efficacy of four commonly-immune therapeutic agents were help in choosing the most effective therapy/method for the recovery of bovine brucellosis. Availability: Items available for loan: UVAS Library [Call number: 2388-T] (1).
34.
Sero-Diagnosis And Associated Exposure Factors Of Brucelosis Among Trade Animals And Abbatoir Workers
by Madiha Ashraf (2008-VA-43) | Dr. Muhammad Avais | Prof. Dr. Aneela Zameer Durrani | Dr. Ali Ahmed Sheikh.
Material type: ; Literary form:
not fiction
Publisher: 2015Dissertation note: Brucellosis mainly infects food animals such as cattle, buffaloes. Brucella abortus is the principal cause of brucellosis in cattle and is shed from the infected animal at or around the time of calving or abortion. Brucellosis is zoonotic disease transmitted to humans both through Brucella abortus and melletensis.
The present study was conducted on 200 animals privately owned and publically owned abattoir. An epidemiological questionnaire focusing on trade animals as well as husbandry and sanitary practices that could be associated with the risk of Brucellosis infection was completed. Serum samples were collected and analyzed using Rose Bengal Plate Test. The serum samples positive for Brucellosis through RBPT further subjected to enzyme linked Immunosorbent assay. The samples of cattle collected from publically owned abattoir are subjected to the RBPT and the result was 18% and privately owned abattoir have an RBPT result of 10% and samples of the buffaloes are subjected to the test of RBPT as an screening test which was respectively 20% and 8%. The samples are further subjected to the iELISA and the results was shown that through ELISA the result was respectively 12% and 4%. While results for the cattle declared the prevelance of brucella infection through indirect ELISA was 8% and 2% at public and private abattoir respectively. The abattoir workers had a high risk to the exposure to the transmission of the disease as it is world widely more zoonotic the workers found positive for the brucellosis at public abattoir through RBPT shown no positive results. While in private abattoir through RBPT there is 6.66% animals were positive. However we concluded the results through indirect ELISA the results found were 66.66% and 15.62% for the butchers and meat sellers respectively at public abattoir.so the butchers are prone to the infection of the brucella antibodies.in comparison with the private abattoir 33.33% was detected in the abattoir cleaner. Through indirect ELISA.
Summary
50
The data originating from this study was tested thorough Chi square test while Odd ratio was calculated for risk factors. Statistical analysis was done using “SPSS version 20” and probability level <0.05 was considered significantly different. Availability: Items available for loan: UVAS Library [Call number: 2387-T] (1).
35.
Comparison Of Oral And Ventral Laryngotomy Approaches Of Vocal Cordectomy In Dogs
by Zohaib Khan (2013-VA-612) | Dr. Uzma Farid Durrani | Dr. Asim Khalid Mahmood | Prof. Dr. Aneela Zameer Durrani.
Material type: ; Literary form:
not fiction
Publisher: 2015Dissertation note: Phonation is a way of communication for dogs and it quite normal for dog to bark under certain conditions but sometimes due to mismanagement and negligence too much phonation may become the worst part of dog keeping causing nuisance. There are different techniques that can be adopted to treat this problem. One of these techniques is surgical devocalization. Devocalization refers to the partial or complete excision of vocal cords that emit sound.
The present study was conducted on 10 clinical cases of dogs divided into 2 groups, each with 5 dogs. One group was operated for vocal cordectomy through oral approach while the other group was operated for vocal cordectomy through ventral laryngotomy approach. The parameters of this research were studied for the period of 2 months.
The study results were analyzed using Chi-square test on SPSS version 17.0. The results showed that in early post surgical period there was no significant difference of phonation after both surgical techniques however, a significant difference of phonation was observed between dogs operated through oral and ventral laryngotomy surgical techniques of vocal cordectomy during late post surgical period means 10 days after surgery.
On the basis of the results of this study it was concluded that ventral Laryngotomy approach is better than oral approach for vocal cordectomy in terms of better controlled of hyper phonation however, ventral laryngotomy approach is likely to be associated with a higher chances of post surgical complications Availability: Items available for loan: UVAS Library [Call number: 2414-T] (1).
36.
Comparative Efficacy Of Autograft And Synthetic Bone Graft For The Repair Of Bone Defects
by Amjad Islam | Dr. Zia Ullah | Dr. Asim Khalid Mahmood | Prof. Dr. Aneela Zameer Durrani.
Material type: ; Literary form:
not fiction
Publisher: 2015Dissertation note: Bone graft was considered as the most commonly transplanted tissue to enhance ability to heal fractures, fracture complications and bone defects. Autologous (or autogenous) bone grafting involves utilizing bone obtained from the same individual receiving the graft. Autogenous bone graft was considered to be the gold standard for replacement of lost tissue. New bone graft substitutes have been devised in recent decades such as synthetic bone graft i.e. poly methyl methacrylate (PMMA), demineralized bone matrix (DBM), bone morphogenetic proteins (BMPs), calcium phosphate (CP), calcium sulfate (CS), hydroxyapatite (HA), highly purified bovine and xenograft , but clinical evidence of their efficacy varies among clinical and experimental studies.
Autograft (along with full cerclage wiring) was a better technique than poly methyla methacrylate (PMMA) for repair of bone defects in animals.
A total of 16 rabbits were divided into two groups i.e. group I and group II, 12-14 weeks of average age having average body weight of 1.5 kg were selected randomly and maintained at Pet Centre, Department of Clinical Medicine and Surgery, UVAS, Lahore. Then, a defect were experimentally created having dimension 4.5 mm wide and 8 mm deep using a lateral surgical approach in left femur in all the animals of each experimental group. Post-operative evaluation was done on the basis of radiological findings, degree of lameness and histopathology findings for the comparison of autograft and synthetic bone graft.
Summary
68
Conclusion
It was concluded from the present study that autograft was superior to poly methyl methacrylate by radiological findings, degree of lameness and histopathological findings. Autografting was the gold standard for fracture healing to be biocompatible, osteogensis, osteinductive and osteoconductive. Availability: Items available for loan: UVAS Library [Call number: 2407-T] (1).
37.
Characterization And Phylogenetic Analysis Of Neuraminidase Gene Of Avian Influenza Virus Subtype H9N2
by Muhammad Abid (2014-VA-502) | Prof. Dr. Tahir Yaqub | Dr. M. Zubair Shabbir | Prof. Dr. Aneela Zameer Durrani.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: The H9N2 AIV are endemic in Pakistan since 1998 and causing serious outbreaks in poultry industry leading to increased morbidity and mortality, reduced egg production and reduced weight gain thus causing great economic losses. As these viruses have segmented genome so there is a lots of antigenic shift, antigenic drift and genetic reassortment which results in the production of new AIV subtypes. Besides causing significant losses the poultry industry, the H9N2 AIV pose a significant threat to public health and this issue has been pronounced with the fact that these viruses caused infections in Chinese children in 1999. This primary focus of this study was to characterize and to determine the phylogenetic relationship of the N2 gene of H9N2 AIV prevalent in Pakistan with other H9N2 viruses. A total of 10 H9N2 AIV were isolated from 100 samples and analyzed through serological and molecular tests. N2 gene of three isolates was amplified and sequenced.
The isolates showed 99% homology with the H9N2 AIV recently isolated from Pakistan and their phylogenetic analysis revealed that all belonged to the same G-1 lineage and fell in clusters of more recently and closely related H9N2 viruses. There were some amino acid substitutions in different positions of the NA gene as compared to previous H9N2 viruses of Pakistan and these substitutions were the same to other H9N2 viruses isolated in 2015 from Pakistan.
Due to the mutating nature of the H9N2 AIV there is need for the continuous surveillance and characterization of the prevailing H9N2 avian influenza viruses as these virus have the potential to cause serious outbreaks in poultry and also pose a significant threat to the public health. Availability: Items available for loan: UVAS Library [Call number: 2458-T] (1).
38.
Comparative Potency Of Two Different Trivalent Vaccines Against Foot And Mouth Disease In Cattle Around The Area Of Ravi Campus Pattoki
by Muhammad Fahimullah Khan (2009-VA-137) | Prof. Dr. Aneela Zameer Durrani | Dr. Muhammad Ijaz | Dr. Jawad Nazir.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: Foot and Mouth Disease is a highly contagious viral disease of all cloven footed animals.
The best control strategy of this disease is effective and in time vaccination. A successful
vaccination campaign depends on the serotype identification and specific vaccination against the
prevalent serotype of the virus. The present study was designed to evaluate comparative potency
of two anti-FMDV vaccines (UVAS-FMD, Deccivac Intervet) used in cattle around areas of
Lahore Pakistan. Blood samples were taken from vaccinated animals on day 0, 30, 60 and 90
post priming. Antibody titer was evaluated with different route of administration and various
adjuvant based vaccines. Four animal groups were made each containing 5 animals; in group 1
UVAS vaccine was used by Sub/ Cut route (gel based) at priming dose, followed by Intra
Muscular (oil) on 30th day. In group 2 UVAS vaccine was given I/M (oil) as priming dose and
booster (oil) I/M. In group 3 Deccivac (oil) vaccine was used I/M for priming and boosting. In
group 4 Deccivac (oil) vaccine was used as Sub/ Cut for priming and boosting. The results
revealed non-significant difference (p>0.05) among the four different groups administered with
FMDV vaccines when evaluated at day 30 and significant difference (p<0.05) at day 60 and 90
post vaccination. Analysis of variance showed significant difference (p<0.05) in antibodies
between groups and with in groups at day 60 and 90. Gel based vaccine gave quick antibody
response which later maintained with oil based booster dose. The difference in antibody titers
obtained in the present study was found non-significant (P>0.05) between the antibody titers of
FMD trivalent vaccine of UVAS and Deccivac at 90th day of inoculation. There was significant
difference (p<0.05) between the adjuvants of vaccine. Animals inoculated with priming dose of
gel based vaccine followed by oil based boosting showed significantly high anti FMD antibody
titer than animals inoculated with oil for both priming and boosting. There was significant
Summary
54
difference (p<0.05) between the groups vaccinated with various routes of administration. The
animals inoculated with priming dose through s/c followed by boosting dose i/m showed
significantly high anti FMD antibody titer at 90th day of inoculation compared with those
inoculated intramuscularly for both priming and boosting. The animals inoculated with oil based
vaccine for both priming and boosting through S/c showed marked significant decreased in anti
FMD antibody titer. The route of administration revealed significant difference (p<0.05) in
antibody response within groups and between groups at day 30, 60 and 90. In all three readings
the mean for sub/cut priming and IM boosting were found significantly high (p<0.05) as
compared to other routes. In conclusion it is recommend from the study that FMD vaccination
with sub/cut priming and booster dose with IM route. Availability: Items available for loan: UVAS Library [Call number: 2499-T] (1).
39.
Sero-Epidemiology Of Johne’s Disease Along With Its Effect On Serum Biochemical Profile In Cattle In District D.I. Khan, Khyber Pakhtunkhwa
by Nasrullah (2009-VA-90) | Prof. Dr. Aneela Zameer Durrani | Dr. Waseem Yaqub | Dr. Mamoona Chaudhry.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: Johne’s disease (JD) or Paratuberculosis caused by Mycobacterium avium subsp.
Paratuberculosis (MAP) is characterized by an incubation period of several years. It is a chronic
non-treatable disease of animals causing enteritis which ultimately leads to economic losses to
dairy and meat industries worldwide. To estimate sero-epidemiology of the JD through ELISA is
inexpensive, efficient, single step and sensitive for the detection of antibodies in cattle and
buffaloes. So, keeping in view the economic and public health significance of the disease, the
present study was designed with the objective to estimate the sero prevalence of JD using
indirect ELISA and to quantify the effect of JD on the level of serum proteins in cattle of D. I.
Khan district, Khyber Pakhtunkhwa Province. Johne’s disease is prevalent in cattle of D I Khan
that affects serum proteins level in dairy animals.
For the study animals were well restrained and about 5 ml blood was collected in Non-
EDTA coated vacutainer from the jugular vein of each animal using 5 ml disposable syringe,
after collection and proper labeling samples were transferred in Ice packed cooler to
Microbiology laboratory, Govt. College of Veterinary Sciences D.I Khan. Serum was collected
at the top of the vacutainer with the help of disposable pipette and was stored in eppendorf tubes
in deep freezer until transported to University of Veterinary and Animal Sciences, Lahore for
further analysis. Data was captured on questionnaires about the clinical signs and symptoms,
management practices and possible risk factors associated with Johne’s disease, was obtained
from the owners.
Summary
40
The collected serum samples were analyzed by Indirect ELISA using commercial ELISA
kit (Mycobacterium Paratuberculosis Antibody Test Kit, IDEXX, USA) according to
manufacturer instructions.
The ELISA positive samples were processed further for the estimation of serum protein analysis
using Biuret method (Doumas et al. 1981;Spencer and Price. 1977).The serum albumin was
determined by Photometric colorimetric test (Bromocresole green (BCG) method (Spencer and
Price. 1977).The globulin will be estimated by subtracting serum albumin from serum total
proteins (Javed et al. 2010).
Data regarding sero-prevalence by indirect ELISA were analyzed through Pearson's Chisquare
Test, while data regarding the effect on serum protein was analyzed by simple t-test using
statistical package for social sciences (SPSS) version 20. P < .05 was considered significant.
The present study demonstrated (12.7%) prevalence of MAP in cattle population of D.I
Khan. There were no significant effect of MAP on serum biochemical profile. The results of all
variables studied as under breed, gender, age, vaccinated status and management system. The
most frequent level was observed in females 13.7% as compared to males 0% (0/4). Among
different age groups, higher sero-prevalence 33.3% were present at age group above 6 years
while sero-prevalence of 7.1% in 2-3 years and 0% were recorded in age group 4-6 years.
Statistically a significant different were present between these groups. Moreover, there was no
relationship of vaccination status with disease because the prevalence recorded 16.6% and
vaccinated cases positive were recorded 0% but there was no significance difference among two
groups of animals. Breed wise risk factor statistically significant because the MAP cases were
highly prevalent in non-descript cattle 25% as compared to crossbred 5.8% and Sahiwal 0%
cattle breed. BCS category I had highest prevalence 66.6% while in BCS category II prevalence
Summary
41
was 23.8% and in BCS category III the prevalence was 0% recorded. Statistically the BCS of the
disease animals was significantly associated. Highest prevalence 100% were recorded above 60
days of diarrhea duration while 0% were recorded less than 60 days of diarrhea duration.
Statistically the sero-prevalence of diarrhea duration was highly significant. Management wise
sero-prevalence of Johne’s disease on the type of housing was higher in open 19.2% as compared
to confined 6.8% showing non-significant difference statistically. Sanitation wise seroprevalence
were higher in poor 19.2% as compared to good sanitation 6.8% showing also nonsignificant
difference statistically. Sero-prevalence of disease was less in well water 0% as
compared to tap water 25% showing there were a significant difference between the seroprevalence
of Johne’s disease under different water conditions. The results of total protein
analysis was statistically non-significant. Availability: Items available for loan: UVAS Library [Call number: 2526-T] (1).
40.
Anthelmintic Resistance In Gastrointestinal Nematodes Of Cattle At District Dera Ghazi Khan Punjab
by Ahsaan Ullah (2014-VA-210) | Dr. Nisar Ahmed | Dr. Haroon Akbar | Prof. Dr. Aneela Zameer Durrani.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: Anthelmintic resistance in nematode parasites of grazing livestock is now common throughout much of the world and poses a significant threat to the productivity and/or profitability of farming operations in many countries. In many cases, the presence of resistance does not jeopardise effective worm control, which can be maintained simply by switching to use of an alternative class of anthelmintic to which resistance has not yet developed. It is an inevitable conclusion that consideration of anthelmintic resistance and its management should be an integral component of anthelmintic use regardless of country or host species. Resistance to anthelmintic drugs by gastrointestinal nematodes infecting ruminants has been demonstrated throughout the world. 6.2 Hypothesis Anthelmintic resistance is prevalent in gastrointestinal nematodes of cattle in 3 different union councils, Darkhast Jamal Khan south, Darkhast Jamal Khan north and Darkhast Jamal Khan Nawan of district Dera Ghazi Khan (D.G.Khan), Punjab.
6.3 Parameters/Methodology
The present study was conducted at 3 union councils, Darkhast Jamal Khan south, Darkhast Jamal Khan north and Darkhast Jamal Khan Nawan of the district Dera Ghazi Khan
A total of 100 fecal samples were collected from the cattle by convenience sampling method to check the anthelmintic resistance against gastrointestinal nematodes in the cattle. The inclusion criteria of the animals for the present study was,
(I) All selected animals were 1-3 years of age
CHAPTER 6
SUMMARY
Summary
29
(II) Animals not dewormed during 60 days prior to the study
For diagnosing the presence of gastrointestinal nematodes resistant to oxfendazole and levamisole, the Faecal Egg Count Reduction Test (FECRT), recommended by the World Association for the Advancement of Veterinary Parasitology was used. On day 0, a sample of feces was collected directly from the rectum of each animal (using a labelled plastic bag). Faeces were transported in a plastic cooler (4◦C) to the parasitology lab, University of Veterinary and Animal Sciences, Lahore. Faecal egg count (FEC) was determined using the McMaster technique. On day one, animals were distributed according to their parasite loads (balanced) into three experimental groups: firstly a control group having 20 animals maintained without treatment, secondly a treatment group with oxfendazole having 10 animals in which EPG was 150 or above, maintained with treatment and thirdly another treatment group with levamisole having 10 animals in which EPG was 150 or above, maintained with treatment. Fourteen days after treatment, another faecal sample was obtained from each animal to calculate the Faecal Egg Count Reduction as mentioned previously.
6.4 Statistical Analysis Appropriate statistical test (like Chi2 and ANOVA) was applied using statistical software like SPSS version 21. Anthelmintic resistances was calculated using formula by (Coles et al. 1992) and RESO© software (CSIRO,1990, Animal Health Division) as mentioned below,
Percentage reduction (%) = (1 –T/C) × 100
where T is the arithmetic mean of EPG of the treated group, and C is the arithmetic mean of EPG of the control group after treatment (at day 14). Availability: Items available for loan: UVAS Library [Call number: 2512-T] (1).
41.
Detection of Antibodies For Mycobacterium Avium Sub-Specie Paratuberculosis in Sheep Population Along With Its Associated Risk Factors in District Rahim Yar Khan
by Muhammad Arif Rizwan (2014-VA-228) | Dr. Waseem Yaqub | Prof. Dr. Aneela Zameer Durrani | Dr. Arfan Ahmad.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: Johne’s disease (JD), caused by Mycobacterium avium subsp. paratuberculosis, is a chronic enteric disease of ruminants. The disease manifest itself in sense of trade restrictions production losses. Mycobacterium avium subsp. paratuberculosis(MAP) is manifested by an incubation period of several years. During subclinical stage of infection, paratuberculosis pass out in feces through which the disease get approaches to other animals in herd. It is also shed in the milk of infected animal, cannot be killed even on pasteurization and in human beings cause a disease (Crohn's disease). Johne’s disease is somewhat difficult to detect in animals having sub clinical infection.
Moreover, the animals in the early stages of infection is often has an immune response that is detectable by ELISA which is not elicited by the animal in time. ELISA is affordable, efficient, one-step and in sheep and goats is very sensitive for the detection of antibodies. So, keeping in mind the economic and public health importance of this disease, present study was formulated with the purpose to detect the MAP in sheep in district in Rahim Yar Khan.
5 ml blood samples, total 100 (n=100 sheep) blood sample out of which 50 animals were selected on the basis of clinical signs (shooting diarrhea, decrease in milk production and weight loss in spite of good appetite) and 50 animals were selected from the surrounding exhibiting no clinical signs but on suspicion of being carrier from local animal markets, different slaughtering site of animals and in periphery of District, RahimYar Khan. The data regarding all the animals was collected on a predesigned questionnaire. Serum was separated by centrifugation and was stored in deep freezer having temperature (-400 C) until analyzed by indirect ELISA through commercial ELISA, Mycobacterium Paratuberculosis Antibody Test Kit (IDEXX Paratuberculosis Screening) and results was recorded through ELISA reader. The ELISA positive serum samples was processed further for the estimation of serum protein analysis. Sero-detection of antibodies for Mycobacterium avium sub-specie paratuberculosis (MAP) was estimated based on indirect ELISA results.
In present study the overall prevalence in sheep for mycobacterium avium sub specie paratuberculosis in district Rahim Yar Khan in different marketed and slaughtering animals irrespective of breed age and sex. When the serum samples of the suspected sheep were subjected to the serum biochemistry for analysis of total proteins in the body of sheep, it was overall decrease in the serum proteins of the sheep (p<0.05) which were infected with MAP while using the paired t-test statistics. On the other hand, it was found 92% malnutrition, 77% poor sanitation, 85% combine housing, 87% open grazing and 29% tick infestation they may act as a source of infection for spreading of paratuberculosis.
Sheep than goats is high in the prevalence of the MAP. There is no doubt that Johne’s disease infected herds may suffer severely. However, as a whole, the economic loss to the sheep industry is of questionable significance. Johne's disease is zoonotic potential threat that it represents as a problem. The sheep industry is in an exceptional position, given its low incidence or occurrence of paratuberculosis to set in motion a strategy to confine or control the spread of malady. The national control of MAP will be a huge undertaking because of subtle nature of this disease and relatively poor performance of tests that are currently available.
It is necessary to develop specific best management practices in the sheep industry, taking into account the biology and ecology of the disease. The implementation of the program against Johne's disease is an important proactive step.However, MAP has struck the sheep industry for many years and will probably continue to remain a major challenge for the foreseeable future.
Availability: Items available for loan: UVAS Library [Call number: 2519-T] (1).
42.
Effect Of Trehalose And L-Cysteine On Post Thaw Semen Quality, Antioxidant Enzyme Activity And Fertility In Nili Ravi Buffalo Bulls
by Sajid Iqbal | Dr. Amjad Riaz | Dr. Syed Murtaza Hassan Andrabi | Dr. Syed Murtaza Hassan Andrabi | Prof. Dr. Nasim Ahmad | Prof. Dr. Aneela Zameer Durrani.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: Addition of various antioxidants in semen extender is one of the vital strategies being applied in reproductive biology for attaining functionally/structurally integral sperms and hence an appropriate conception rate. It is well established that chilling of buffalo semen results in decreased semen quality which is highly associated with decreased antioxidant activity and higher ROS production. Furthermore, buffalo bull spermatozoa are more susceptible to oxidative damage as compared to cattle bull spermatozoa. It is believed that this difference is due to higher contents of polyunsaturated phospholipids present in plasma membrane of buffalo bull spermatozoa. Freezing process accelerates the production of ROS molecules which may decrease the viability of buffalo bull spermatozoa during storage. Therefore, supplementation of antioxidants in semen extender is required to decrease the ROS-mediated damages to buffalo spermatozoa. The present study had, hence, been designed to monitor the effects of trehalose and L-Cysteine on the semen quality, antioxidant enzyme activity and fertility of Nili Ravi Buffalo bulls.
Semen samples (n= 20) from 4 buffalo bulls were diluted in Tris-citric acid based extender having different concentrations of trehalose (0.0, 15, 30, 45, and 60 mM) and frozen in French straws. At post dilution, profile of sperm catalase (U/mL) was higher (P < 0.05) in extenders containing 15, 30 and 45 mM of trehalose as compared to control. While profiles of superoxide dismutase (U/mL) and total glutathione (μM) were higher (P < 0.05) in extenders containing 15 and 30 mM of trehalose as compared to control. At pre freezing, sperm catalase, superoxide dismutase and total glutathione profiles were higher (P < 0.05) in all the treatment groups as compared to control. At post thawing, the profiles of catalase and total glutathione
were higher (P < 0.05) in extender containing 30 mM trehalose as compared to other treatment groups and control. Whereas, profile of superoxide dismutase was higher (P < 0.05) in extenders containing 30, 45 and 60 mM of trehalose as compared to control and 15 mM group. Post thaw total sperm motility (%) was higher (P < 0.05) in extender containing 30 mM trehalose as compared to control and 15 and 60 mM groups. While sperm progressive motility (%), rapid velocity (%), average path velocity (μm/s), straight linear velocity (μm/s), curvilinear velocity (μm/s), plasma membrane (structural and functional, %), acrosome (%) and DNA (%) integrity were higher (P < 0.05) in extender containing 30 mM trehalose as compared to other treatment groups and control. The fertility rates (61% vs. 43%) were higher (P < 0.05) in buffaloes inseminated with semen doses cryopreserved in extender containing 30 mM of trehalose than the control. It is concluded that addition of 30 mM trehalose in extender improves the semen antioxidant enzymes activity, post thaw quality, and fertility in Nili Ravi buffaloes.
Similarly Semen samples from 4 buffalo bulls were diluted in Tris-citric acid based extender having different concentrations of L-cysteine (0.0, 0.5, 1.0, 2.0, and 3.0 mM) and frozen into 0.5 ml French straws. The antioxidative enzymes [catalase, super oxide dismutase and total glutathione (peroxidase/reductase)] were significantly higher (P< 0.05) at pre freezing and post thawing in extender containing 2.0 mM L-Cysteine as compared to other groups. Post thaw total motility (%), progressive motility (%), rapid velocity (%), average path velocity(μm s-1), straight line velocity (μm s-1), curvilinear velocity (μm s-1), beat cross frequency (Hz), viable sperm with intact plasmalemma (%), acrosome and DNA integrity (%) were higher with addition of 2.0 mM L-cysteine as compared to other groups (P < 0.05). The fertility rates (59 vs. 43%) were higher (P < 0.05) in buffaloes inseminated with doses containing 2.0 mM of L-cysteine than the control. In conclusion, addition of 2.0 mM L-cysteine in extender improved the
SUMMARY
77
antioxidant enzymes profile, post thaw quality and in vivo fertility of Nili Ravi buffalo bull spermatozoa.
Conclusion
It was concluded that addition of 30mM Trehalose and 2.0mM L-Cysteine in semen extender has significantly improved semen antioxidant enzymes activity, post thaw quality and fertility in Nili Ravi buffaloes. Availability: Items available for loan: UVAS Library [Call number: 2550-T] (1).
43.
Evaluation Of Risk Factors And Molecular Diagnosis Of Dermatophytosis In Dogs
by Muhammad Haseeb Saeed (2008-VA-241) | Prof. Dr. Aneela Zameer Durrani | Dr. Hassan Saleem | Prof. Dr. Azhar Maqbool.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: Dogs are most kept and beloved pets in Pakistani society. Dermatophytosis is among the common disease of the pets. Many predisposing factors are involved in development of clinical cases of dermatophytosis including climatic conditions, housing condition of dogs and physical attributes such as coat hair size. Dermatophytosis is not only of concern as being infection of pets but also of its zoonotic importance hence it is very crucial to diagnose dermatophytic infection well in time. Dermatophytosis is caused by Dermatophytes,Microsporum, Trichophyton and Epidermophyton, the fungal species. It is difficult to diagnose the Dermatophytosis from other skin infections by routine tests in most of the cases especially subclinical. Polymerase Chain Reaction (PCR) is advanced and the most reliable technique to detect genome of Dermatophytes even in minute quantities specifically and can efficiently detect the presence of any Dermatophyte specie on the skin of dog. The current study was planned to develop and validate a diagnostic assay which could be able to detect and distinguish tree important dermatophytes species including Microsporum, Trichophyton and Epidermophytonby a uniplex PCR reaction. Analysis of involvement of certain predisposing factors in dermatophytosis was second goal to be worked on in this study. Samples of suspected pet dogs (n=50) were collected by scraping the skin at affected areas over skin. DNA was extracted from the skin scraping samples by organic Phenol Chloroform Isoamyle Alcohol method. Primers, specific to the 18-S ribosomal RNA region of genomes of the Dermatophytes, were designed after alignment of available sequences of Microsporum,Trichophyton and Epidermophyton at NCBI. Annealing temperature and recipe of PCR reaction was optimized by gradient PCR in BIO-Rad thermal cycler. Amplification reaction of all samples collected was carried out as per optimized reaction conditions, afterwards. Amplified products obtained were subjected to genotyping by agarose gel electrophoresis for size based separation of the amplified products. The specific amplified bands of desired genomic region of dermatophytes were seen in UV light transilluminator. The data of results of predisposing factors involved in dermatophytosis wasanalysedby using Pearson’s chi squared test with the help of Statistical Package for the Social Science (SPSS) Program.
Genome specific product sizes of Microsporum and Trichophyton i.e. 366 bp and 351 bp in respective positive samples were observed. Out of 50 suspected samples 46 samples were positive for dermatophytosis out of which 38 samples (82.6%) were positive for Microsporum, 6 samples (13%) for Trichophyton and 2 samples (4.4%) were positive for both Microsporumand Trichophyton.
This study will help to validate a diagnostic technique for Dermatophytosis with greater efficacy and reliability. Moreover, this investigation may become basis for the future research activities in this field in Pakistan.
Availability: Items available for loan: UVAS Library [Call number: 2528-T] (1).
44.
Study On Prevalence Of Intestinal Nematodes In Buffalo And Comparative Efficacy Of Herbal And Conventional Drugs Against Intestinal Nematodiosis In Buffalo Calves
by Abdul Rehman Qureshi (2014-VA-09) | Prof. Dr. Kamran Ashraf | Dr. Imran Rasheed | Prof. Dr. Aneela Zameer Durrani.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: Parasites are a major cause of disease and production losses in livestock, frequently causing major economic loss and impacting on animal health. In livestock roundworms are deliberated the important economically upsetting internal parasites. Although buffalo can be diseased with tapeworms and flat worms, their effect on animal performance is minimal compared to the round worms. Buffalo feed on dry concentrate are less infected with parasite as compared to those who fed on pastures. The timing and frequency of anthelmintic treatments under such climatic conditions will vary greatly from place to place. Humid climates are permanently favorable for the development of infective larvae. With the frequently use of one or more dewormer animal produces anthelmintic resistance also its cost a lot for large herds. Herbal medicine is better option for control of intestinal worms. Herbal drugs are cheap, easy available and easy in administration.
The present study was designed to
1. Check the prevalence of intestinal nematodes in the buffalo population.
2. To determine the efficacy of herbal drugs against intestinal Nematodes in buffalo calves
3. To evaluate the comparison of effectiveness between herbal and commercial drugs to control the intestinal Nematodiosis in buffalo calves.
One hundred buffalo’s faecal samples were examined to check intestinal nematodes prevalence. All buffaloes belonging to various breeds were examined. 56 (93.33%) were Mix breed, 13 (72.22%) Nili Ravi breed and 18 (81.82%) of Kundi breed were positive for intestinal nematodiosis. 47
SUMMARY
Among the examined (87 %) buffaloes were found positive for nematodiosis. Ten buffaloes found positive (10 %) were less than 12 months, 25 buffaloes were between 1-2 year, 39% buffaloes were between 2 - 4 year and 13 buffaloes were above 4 years old were found positive for intestinal nematodiosis.
Among these buffaloes, 65 were male and 35 females. Out of male buffaloes 55 were found positive. While among 35 females 32 were positive for intestinal nematodes.
A total of 30 infected buffalo calves, of various ages (8-12 months), both sexes average body weight of 100 kg and naturally infected with intestinal nematodiosis were used for anthelmintic trials. These were randomly divided into 3 groups i.e. A, B, and C each having 10 calves. Group A and B were treated with herbal medicine. Group A was treated with dried powder Nigella Sativa (Kalonji) seeds at dose level of 250 mg/kg body weight. Group B was treated with Citrullus colocynthis (Kor Tumbha) fruit dried powder at dose level of 250 mg/kg body weight, group C was treated with Albandazole at dose level of 7.5 mg / kg body weight. The sample were taken on 0 day, 7th day, 14th, 21st and 28th day and EPG was determined by modified McMaster technique.
Statistical analysis was done using the statistical package for social science, (SPSS) version 20 (Chicago IL, USA). Data was presented as (mean+ S.D), the group descriptive measures were compared by CR Design (Anova) and applying differences were considered significant at P < 0.05. Post hoc test using Duncan multiple range test, to check the pair wise differences and alpha M. There was highly significant difference between commercial and herbal drugs. There was small significant difference between herbal drugs Nigella sativa and Citrullus 48
SUMMARY
colocynthis, both were highly effective against intestinal nematodiosis but less effective than Albandazole.
It is observed Nigella sativa dose showed a significant reduction in EPG .p value is p > .2284 at o day and at 7th day P>0.0146 ,at 14th day p> .0029 . There was also a significant decrease in EPG by Citrullus colocynthis but when compared these herbal drugs with commercial drugs the efficacy of herbal drug is 100 % at 21st day.
Recommendation.
Both herbal drugs Nigella sativa and Citrullus colocynthis used in trial were found highly effective against intestinal nematodiosis in buffalo calves but less effective than synthetic drug Albandazole hence, these herbal drugs cannot be recommended to be used as routine deworming of animals at farm level.
Keeping in view effectiveness of these herbal drugs in early age and having no side effects, it is recommended to be administered as feed additive to enhance immune-potentiation, effective anthelmintic and liver tonic.
There is dire need to carry out more research with increased dose rate of these herbal drugs and also use in combination with other herbal as well as synthetic drugs to evaluate its synergistic effect so farmer can be benefited of its maximum potential. Availability: Items available for loan: UVAS Library [Call number: 2637-T] (1).
45.
Study On The Repair Of Long Oblique Mid-Shaft Femoral Fracture In Domestic Fowl, Using Full Cerclage Wires With Or Without Intra-Medullary Pin
by Muhammad Waqas (2008-VA-224) | Prof. Dr. Muhammad Arif Khan | Dr. Hammad Bin Rashid | Prof. Dr. Aneela Zameer Durrani.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: Fracture is a challenging problem in domestic as well as wild birds. Caged birds are
prone to stress and self-injury. Wing and leg fractures in birds are most common problems. The
fracture of bones is common in avian species as a result of impact injuries due to collision with
branches, electric lines or other obstacles, either natural or anthropogenic. The basic principles of
fracture fixation are the same in birds and mammals. Fractures treated with biomechanically
sound fixation and proper attention to soft tissues will be most likely to heal with a functional
outcome. However, osteomyelitis, bone sequestration, and joint ankylosis still continue to be
major factors in inhibiting healing and bone functionality.
This research project was designed with the aim to test the effectiveness and accuracy of
three sets of bone splintage devices in healing long oblique mid-shaft femoral fractures in birds,
with minimal side effects and stress to the patient.
The Study was conducted on 12 adult, domestic fowls of either sex. The birds were
received as clinical cases presented with long oblique femoral fracture at Pet Centre, University
of Veterinary & Animal Sciences Lahore. They were individually marked with coloured plastic
rings for the sake of identification. They were divided into three groups i.e. Group A , Group B
and Group C comprising four birds each, which were designated as I, II, III, and IV respectively.
In the birds of Group A long oblique femoral fracture was reduced and immobilized with
intramedullary pinning, with pin size between 2.5mm to 3.0mm. While in Group B, similar
fracture was treated with 2 – 3 full cerclage wiring. And in the final Group C both of the above
techniques were applied simultaneously i.e. IM pin with 2 – 3 cerclage wires. The birds were
maintained in separate cages post-operatively until the completion of the study.
Subsequent comparative parameters were studied which included physical examination
of wound, lameness grading, radiological scoring for callus formation, fracture line union,
SUMMARY
74
fracture alignment as well as callus remodelling. The collected data regarding study parameters
was illustrated by descriptive statistics and non-parametric analysis of variance (Kruskal Walis
Test) using IBM SPSS Statistics version 20.
Conclusion:
Therefore, as advocated by the results of this study, intramedullary pinning (preferably
threaded) with at least 2 – 3 full cerclage wiring was a better choice for the correction of a long
oblique mid-shaft femoral fracture in domestic fowl. The combination of both these techniques
together give a strong backbone for bone healing to take place with minimum amount of stress to
the bone fragments. Both these techniques were easy, required little soft tissue manipulation,
were cost-effective, required less equipment and could easily be applied by an average
practitioner. Availability: Items available for loan: UVAS Library [Call number: 2653-T] (1).
46.
Histopathological Studies On Caprine Mastitis Correlating Lesions With Etiology In Natural Infection Prevailing In Lahore Abattoirs
by Salman Ahmed Abid (2014-VA-536) | Prof. Dr. Zafar Iqbal Chudhary | Prof. Dr. Asim Aslam | Prof. Dr. Aneela Zameer Durrani.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: Mastitis is a common disease of cattle, buffaloes, dairy and non-dairy goats associated
with the inflammation of mammary parenchyma, protracted production loss, risks of premature
culling from the herd and the release of injurious toxins in the udder. IMIs in dairy goats can
cause economic losses due to decreased milk production as well as risks to public health and
discarded milk.
A total of one hundred goats affected with mastitis were included in this study. Samples
were collected from the abattoirs of Lahore. Mastitis was diagnosed on the basis of visible and
palpable changes in udder and milk. Pre-slaughter and post slaughter examination of udder was
performed and gross lesions were observed. Samples included udder parenchyma and
supramammary lymph nodes from mastitis affected goats. Each sample was divided into two
parts, one part was placed in small polyethene bag in an ice box under aseptic conditions for
bacteriological examination and second part was fixed in 10% neutral buffered formalin solution
for histopathological evaluation. Samples were cultured for identification of staphylococci,
streptococci and E.coli on Staph 110, Blood agar and MacConkey’s agar respectively.
Biochemical tests were also performed for confirmation of these bacteria. Confirmation was
made on the pattern of reactivity of bacterial cultures to biochemical tests.
Bacteriological investigation demonstrated the different species of bacteria involved
commonly in caprine mastitis. Staphylococcus aureus was isolated from 21 cases, CNS from 10
cases, Streptococcus spp. from 7 cases and E.coli from 3 cases as single infection and 25 cases of
mixed infection were observed in different combination of these bacteria. Results of the study
Summary
47
revealed that Staphylococcus aureus is associated with statistically significant changes in udder
parenchyma as well as in supramammary lymph nodes. Marked changes have been observed in
case of tissue necrosis, exudation and gangrene. Moreover, tissue responses to mononuclear cell
infiltration have also been observed significant in Staphylococcus aureus infection. CNS,
Streptococci and E. coli revealed relatively comparable changes in tissue with slight variability.
However, mixed infection of these bacteria in a single tissue led to relatively much pronounced
histopathological changes as compared to the solitary infections. This could be attributed to the
synergistic effects of various bacterial activities, enzymes, toxins and host responses to more
than one type to bacteria. Availability: Items available for loan: UVAS Library [Call number: 2652-T] (1).
47.
Study Of Hematological Alterations And Chemotherapeutic Trials Of Camels Naturally Infected With Trypanosomiasis In Cholistan, Bahawalpur
by Zubair Bashir (2014-VA-782) | Prof. Dr. Aneela Zameer Durrani | Dr. Khalid Mehmood | Dr. Muhammad Avais | Dr. Haroon Akbar.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: Trypanosoma evansi (T. evansi) is a flagellated protozoan that is mechanically spread through biting flies like Stomoxys, Tabanus and Lyperosia.T. evansi was first isolated in 1880 from diseased equines and camels of Indian sub-continent. It is the parasite of likewise intravascular as well as extra vascular fluids causing “surra” in the subtropical and tropical regions all over the world, including Africa, Asia, and America. It affects a wide range of mammals. It is mostly observed in camelids and equines but camel is the principal host. Trypanosomiasis in Pakistan is prevalent as a major threat to the camels causing heavy financial losses like causing anemia, weight loss, high fever, anorexia, dullness, depression, pale mucous membranes, facial paralysis, and thin hump dropped to one side, abortion in females and even death of camels.Considering the significance and utilization of camels in our country and the substantial losses rendered by trypanosomiasis, the present study was designed to study incidence, hematological alterations and chemotherapy of trypanosomiasis in camels of Bahawalpur district.
For this purpose, 100 camels were examined for Trypanosoma infection. The blood was collected by ear-tip puncture and from Jugular venipuncture. Then thin blood smear slide was prepared and dried up in air and stained with Geimsa's staining method and examined under microscope. Trypanosomes were identified by their morphological characteristics (Chandler and Read, 1961), as described by standard texts like Taylor et al. (2007). Overall incidence of T. evansi in camels was estimated as 20%.
The effect of trypanosomiasis on various blood parameters (Hb, ESR, TEC, TLC, DLC, and PCV) was determined in 30 camels including 15 apparently healthy and 15 trypanosome infected camels to compare normal blood parameters. The remarkable decrease in Hb, TEC, PCV, platelets and lymphocytes were observed while remarkable increase inESR and TLC was observed.Severe leukocytosis, neutrophilia, monocytosis, eosinophilia and basophilia were also observed in diseased camels.
For chemotherapy, 12 camel’s positive for trypanosomiasis, were divided into three groups (A, B and C). The animals of group A were treated with Imidocarb dipropionate @ 1.2 mg Kg-1 BW I/M, and efficacy of drug was found 50% in camels against trypanosomiasis. The group B was treated with Buparvaquone @ 3 mg/kg BW 1/M and was observed 25% effective. While the group C was treated with Isometamedium chloride(Trypamidium Samorin®, Merial, Pakistan) @ 0.75mg/kg BW I/M, which was found 100% effective. The efficacy of drugs was measured on the basis of disappearance of clinical signs and recovery rate of the animals, and blood smear examination at day 2, 4 and 07 of post-medication.
Finally, the data on hematology were analyzed by Student's T-test using statistical software package SPSS v22 (statistical package for social science), P < 0.05 was considered significant. Considering the significance and utilization of camel in our country and the substantial losses rendered by trypanosomiasis, the present project was designed to record clinical cases and chemotherapy of trypanosomiasis in camels of Bahawalpur districts. The results of this study will help farmers and veterinary practitioners in field.
Availability: Items available for loan: UVAS Library [Call number: 2668-T] (1).
48.
Prevalence And Chemotherapy Of Dry Cow Mastitis
by Abdul Sattar Saqib (2014-VA-766) | Dr. Muhammad Avais | Prof. Dr. Aneela Zameer Durrani | Prof. Dr. Masood Rabbani.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: The study was undertaken to determine the prevalence and chemotherapy of dry cow mastitis. Mastitis is responsible for a wide range of health problems and economic losses in cows and is characterized by decrease in milk production, Swelling of the udder, hotness of the udder and anorexia. All lactating animals generally have a period of 6-10 weeks preceding to calving (usually annually) as a dry or resting period, a non-lactating phase. About to calving the cow remains at risk to new intra-mammary infections, especially shortly after the ‘drying off’ or termination of milking. During the dry period the prophylactic benefit of 82% reduction in the rate of intra-mammary infection is the result of the dry cow treatment with antibiotics and higher rate of eliminating infections than treating in lactation.
For this purpose, 250 Pregnant dry cows were examined for subclinical mastitis. The milk samples were collected from Pattoki and adjacent areas and California mastitis test (CMT) was performed and positive samples were furtherly processed for somatic cell count at medicine Laboratory of University of Veterinary and Animal Sciences, Lahore.
For Chemotherapy, 24 animals positive for dry cow mastitis were equally divided into 4 groups viz A, B, C and D. Each group comprising of 6 animals. The animals of group A were treated with intramammary antibiotic Cloxacilline+ Ampicillin (Masticlox ,ICI). Animals in group B were treated by injecting 2 shorts (72 hours interval) of long acting Amoxicilline (amoxy 150 L.A Floris veterinaire produkten B.V Vught the Netherland) intra muscularly. Animals in group C were treated with Cephradine (Velosef, GSK) 1g/quarter through intramammary route once. Cows in group D were served as positive control. Animals in all groups were kept under close observation for clinical mastitis until parturition. After calving, cows in each group were tested for mastitis at days 7, 14 and 21 (post calving) using CMT and
Summary
53
SCC. Effectiveness of a particular treatment was determined on the basis of CMT score and SCC.
The collected samples from Pattoki and adjacent areas were processed at the Medicine laboratory at UVAS, Lahore aseptically for CMT and CMT positive samples were processed by Somatic cell count (SCC).
Overall prevalence determined which was 39.60% (99/250samples) by CMT and SCC.The efficacy of different antibiotics used in chemotherapy of dry cow mastitis was checked. The efficacy of Amoxicilline (Amoxy 150 L.A), Ampicillin+ Cloxacilline (Masticlox) and Cephradine (Velocef 1g) was recorded at day 7,14 and 21days post calving.
Group A was treated with Ampicillin +Cloxacilline (Masticlox) its efficacy was 83.33% and group B was treated with Amoxicilline (Amoxy 150 L.A) and its efficacy was 66.66% effective while the efficacy of Cephradine (Velocef 1g) was 33.33% in group C.
From this study it was concluded that CMT is more reliable test than other tests for the diagnosis of Mastitis in cows. Secondly subclinical mastitis which is an important problem of cows is significantly prevalent in dry cows in Pattoki and adjacent areas. Cloxacilline+ Ampicillin and Amoxicillin is the most effective drug while Cephradine is relatively less effective against mastitis in dry cows. Availability: Items available for loan: UVAS Library [Call number: 2669-T] (1).
49.
Comparative Efficacy Of Albendazole, Pyrantel Pamoate, Ajwain And Kamala Against Toxocara Vitulorum Infestation In Bovine Calves
by Muhammad Zahid IQbal (2007-VA-72) | Prof. Dr. Aneela Zameer Durrani | Dr. Muhammad Hassan Saleem | Dr. Arshad Javid.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: Toxocara vitulorum is a round worm of cattle and buffalo that is common in tropical and subtropical area.Toxocara vitulorum from infected cattle and buffalo transmitted to calves via colostrum and placenta while its transmission was very less though feed and water. Toxocara vitulorum infestation was very high in calves and it caused mortalities in calve ages between 1 to 3 months, while infestation was less in high age groups.Mortality in cattle and buffalo calves reached up to 50% andcause poor growth, colic, constipation, diarrhea, anorexia and ketosis in calves. These worms could cause intestinal strangulation, holes and blockage in intestines of calves.
Resent study was designed to check the prevalence and therapeutic trial of Toxocara vitulorum in cow and buffalo calves. These results were very helpful for the treatment of the Toxocara vitulorum that was a major endo-parasite in the cows and buffalo calves. Fecal samples from 300 cows and buffalo were examined under the compound microscope for ova. Positive cow and buffalo calves were divided in five groups and different treatments were given to each group. Egg per Gram (EPG) counted at day 7and 14th post-treatment.
Overall prevalence Toxocara vitulorum was 49% in cow calves and 59% in buffalo calves. Prevalence was higher in 1-3 month age group calves (78% in cow calves & 91% in buffalo calves) while prevalence was higher in female calves (52% in cow and 61% in buffalo calves) as compare to male calves (44% in cow and 55% in buffalo calves). Prevalence was higher in the summer stress months.
The efficacy of the Albendazole was lowest in both cows and buffalo calves. The efficacy of Albendazole in cow was 25% and 31% at day 7th and 14th, respectively while in buffalo calves the efficacy of Albendazole was 24% and 31% at 7th and 14th days of post treatment, respectively. The efficacy of Pyrantel pamoate was 98% and 100 % in cow calves at day 7th and 14th, respectively while in buffalo calves the efficacy of Pyrantel pamoate was 81% and 100% at day 7th and 14th, respectively. The efficacy of Ajwain in cow calves was 59% and 69% at day 7th and 14th, respectively while in buffalo calves it was 58% and 69% at day 7th and 14th, respectively. The efficacy of Kamala in cow calves was 33% and 39% at day 7th and 14th day of post-treatment, respectively and buffalo calves the efficacy was 34% and 42% at day 7th and 14th of post-treatment.
It is concluded from the present study that both in cow and buffalo calves, Toxocara vitulorum is most prevalent parasitic infestation. This parasite is more prevalent in female calves, 1-6 months of age and during hot and humid season in both cows and buffaloes. Pyrantel pamoate is proved to be better than Ajwain but Albendazole and Kamala was not justified good dewormer against Toxocariasis in bovine calves.
.
Availability: Items available for loan: UVAS Library [Call number: 2656-T] (1).
50.
Expression, Purification Of Toxoplasma Rop18 Recombinant Protein And Its Antigenic And Immunogenic Trials In Mice
by Habibun Nabi (2010-VA-69) | Dr. Muhammad Imran Rashid | Dr. Nisar Ahmad | Dr. Aneela Zameer Durrani.
Material type: ; Literary form:
not fiction
Publisher: 2016Dissertation note: Toxoplasma gondii is an obligate intracellular, apicomplexan parasite that infects all warm-blooded vertebrates, including mammals and birds. Human beings can be infected by ingestion of oocysts from cat feces or through the consumption of meat containing Toxoplasma gondii cysts. There are potential vaccines candidates among which ROP18 has its major role in host gene expression along with the modulatory effect on key regulators of the host immune system. Therefore in this study, ROP18 sequence was amplified from local T. gondii strain, recombinant ROP18 was expressed through recombinant DNA technology and this recombinant protein was then tested for its antigenicity and immunogenicity in a mouse model. Approximately 200 fecal samples were collected from domestic, wild and stray cats in and around city of Lahore, Pakistan. Oocysts of T. gondii from cat feces were identified by using light microscopy and flotation technique. The oocysts were measured by micrometry having diameter of 8-10 μm. Out of 200 fecal samples, only three were suspected for T. gondii through direct microscopic examination and flotation technique. From 3 fecal samples, genomic DNA was extracted using a stool DNA extraction kit. After DNA extraction, the 3 samples were confirmed and characterized by PCR and nested PCR by using B1 gene and SAG2 primer sets. Reference DNAs (RH) of toxoplasma were kindly provided by Dr. Henrik Vedel Nielsen (Statens Serum Institut, Denmark) and Dr. Jorge Enrique Gomez Marin (COLOMBIA, South America). For detection of the B1 gene of T. gondii, the diagnostic method was optimized to amplify a 529 base pair (bp) repetitive sequence by PCR using DNA extracted from cat feces. Then a nested PCR was employed using internal primers to amplify a 102 bp from 391 bp product. The SAG2 gene was targeted at 5 different regions to amplify 5 amplicons. Genotype analysis was done using SAG2 sequence by Dr.
SUMMARY
132
Jorge Enrique Gomez Marin using 10 different markers. For amplification of ROP18, 54 sequences of the ROP18 gene retrieved from Genbank (National Center for Biotechnology Information (NCBI)) We used Geneious R8.1.6 software for sequence alignment and creating consensus sequence from all 54 ROP18 sequences. Primers were designed manually from the consensus sequence of ROP18. Primer pair namely ROP18-F 5‟ATCTAGAATGTTTTCGGTACAGCGG3‟ and ROP18-R Reverse 5‟TTCGAATTCTGTGTGGAGATGTTCC3‟ were designed to have restriction sites XbaI and HindIII respectively. The rop18 sequence was first cloned in pGMT easy vector system and then subcloned in pET28. BL21 competent cells were transformed with pET28-ROP18 and rROP18 was expression using IPTG for induction. The rROP18 was quantified through protein quantification kit (BCA). The rROP18 was formulated into nanospheres using PLGA as coating material. The Swiss-Webster mice were inoculated either intranasal or subcutaneous with rROP18 with or without montanide as adjuvant 3 times with 2 weeks interval. The blood was collected 2 weeks after each immunization. The control groups were inoculated with PLGA I/n or montanide S/c. For western blotting, ROP18 protein was electrophoresed on SDS-PAGE and blots were immune-blotted with the sera of immunized or infected mice. Bound antibodies were detected through Goat anti-mouse IgG–alkaline phosphatase conjugated. For evaluation of humoral response, ELISA plate was coated overnight at 4°C with rROP18 protein at 5μg/ml in 50mM sodium carbonate buffer (pH 9.6) @ 100 μl/ well. The absorbance of each sample was measured at OD 405 nm using ELISA (Bio-Tek, E-800, USA). Comparisons of quantitative values in the different groups were performed using ANOVA test, after checking the homogeneity of variances. Comparisons between groups for the antibody titre were performed by Dunn multiple range tests test. Comparisons were considered significant when a probability of equality was less than 5% (P<0.05). It was observed that rROP18 in nanospheres administered intranasal elicited
SUMMARY
133
elevated responses of specific intestinal IgA and IgG2a as compared to other groups inoculated intranasally rROP18 alone or injected subcutaneously rROP18 adjuvanted in montanide. It was concluded that nanospheres of ROP18 would be a non-invasive approach to develop vaccination against toxoplasmosis. Further experiments are needed to conclude the cellular response of these nanospheres in a chronic mouse model. Availability: Items available for loan: UVAS Library [Call number: 2680-T] (1).
